Incidental Mutation 'R1517:Gba'
ID167086
Institutional Source Beutler Lab
Gene Symbol Gba
Ensembl Gene ENSMUSG00000028048
Gene Nameglucosidase, beta, acid
Synonymsglucocerebrosidase, GCase, GC, betaGC, GBA1
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89202928-89208966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89206148 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 239 (Y239F)
Ref Sequence ENSEMBL: ENSMUSP00000142401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073572] [ENSMUST00000077367] [ENSMUST00000118964] [ENSMUST00000152789] [ENSMUST00000167998] [ENSMUST00000174126] [ENSMUST00000197738]
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077367
AA Change: Y239F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076589
Gene: ENSMUSG00000028048
AA Change: Y239F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118964
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119222
SMART Domains Protein: ENSMUSP00000113986
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 12 57 1.6e-11 PFAM
Pfam:Tom37_C 138 216 5.4e-24 PFAM
Pfam:GST_C_3 166 282 1.1e-11 PFAM
Pfam:GST_C_2 169 276 1.8e-8 PFAM
Pfam:Tom37_C 199 268 7.2e-15 PFAM
low complexity region 295 314 N/A INTRINSIC
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124086
Predicted Effect probably benign
Transcript: ENSMUST00000129055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138633
Predicted Effect probably benign
Transcript: ENSMUST00000152789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156847
Predicted Effect probably damaging
Transcript: ENSMUST00000167998
AA Change: Y239F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130660
Gene: ENSMUSG00000028048
AA Change: Y239F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 512 1.4e-252 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173239
Predicted Effect probably benign
Transcript: ENSMUST00000173465
Predicted Effect probably benign
Transcript: ENSMUST00000173475
SMART Domains Protein: ENSMUSP00000134110
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
low complexity region 97 116 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173477
SMART Domains Protein: ENSMUSP00000133282
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 1 58 8.5e-16 PFAM
Pfam:Tom37_C 77 155 9.7e-24 PFAM
Pfam:GST_C_3 104 221 8.2e-12 PFAM
Pfam:GST_C_2 107 216 7.5e-9 PFAM
Pfam:Tom37_C 138 207 1.3e-14 PFAM
low complexity region 234 253 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173593
SMART Domains Protein: ENSMUSP00000133866
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 14 82 1.1e-21 PFAM
Pfam:Tom37_C 102 178 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196887
Predicted Effect probably damaging
Transcript: ENSMUST00000197738
AA Change: Y239F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142401
Gene: ENSMUSG00000028048
AA Change: Y239F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_30 20 388 1e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200124
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that cleaves the beta-glucosidic linkage of glycosylceramide, an intermediate in glycolipid metabolism. Mutations in this gene cause Gaucher disease, a lysosomal storage disease characterized by an accumulation of glucocerebrosides. A related pseudogene is approximately 12 kb downstream of this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mutations in this locus variably lower enzyme activity and result in accumulated glucocerebroside in reticuloendotehelial cell lysosomes and glucosylceramide in brain, liver and skin. Severe mutants die perinatally with compromised epidermal permeability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Gba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Gba APN 3 89205841 missense probably damaging 1.00
IGL02661:Gba APN 3 89203527 missense probably benign 0.02
IGL02832:Gba APN 3 89203502 missense probably benign
R0308:Gba UTSW 3 89208364 missense probably benign 0.00
R0811:Gba UTSW 3 89204000 missense probably benign 0.01
R0812:Gba UTSW 3 89204000 missense probably benign 0.01
R2119:Gba UTSW 3 89205561 missense probably benign 0.11
R4613:Gba UTSW 3 89208644 utr 3 prime probably null
R5371:Gba UTSW 3 89205471 missense probably benign 0.37
R5987:Gba UTSW 3 89205822 missense probably damaging 0.98
R6469:Gba UTSW 3 89204081 missense probably benign 0.12
R6470:Gba UTSW 3 89204081 missense probably benign 0.12
R6473:Gba UTSW 3 89204081 missense probably benign 0.12
R6474:Gba UTSW 3 89204081 missense probably benign 0.12
R6475:Gba UTSW 3 89205928 missense probably benign 0.00
R6483:Gba UTSW 3 89208603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTCACCAAGCCCTGAAGATGTCC -3'
(R):5'- ACATCATGGGAACTGTTGGCAAGG -3'

Sequencing Primer
(F):5'- AGACCTGGGCCAATTACTTTG -3'
(R):5'- TCTCTGGTGTTCAGGAGTGA -3'
Posted On2014-04-13