Incidental Mutation 'R1517:Midn'
ID167108
Institutional Source Beutler Lab
Gene Symbol Midn
Ensembl Gene ENSMUSG00000035621
Gene Namemidnolin
Synonyms
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R1517 (G1)
Quality Score133
Status Validated
Chromosome10
Chromosomal Location80148272-80158368 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80154123 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 275 (T275N)
Ref Sequence ENSEMBL: ENSMUSP00000046967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042057] [ENSMUST00000099492] [ENSMUST00000144526] [ENSMUST00000146516] [ENSMUST00000151202] [ENSMUST00000153477]
Predicted Effect probably damaging
Transcript: ENSMUST00000042057
AA Change: T275N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046967
Gene: ENSMUSG00000035621
AA Change: T275N

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 130 143 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
low complexity region 238 262 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 434 453 N/A INTRINSIC
low complexity region 465 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099492
AA Change: T232N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097091
Gene: ENSMUSG00000035621
AA Change: T232N

DomainStartEndE-ValueType
UBQ 32 102 3.39e-7 SMART
low complexity region 154 168 N/A INTRINSIC
low complexity region 195 219 N/A INTRINSIC
low complexity region 240 259 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124179
Predicted Effect probably benign
Transcript: ENSMUST00000144526
SMART Domains Protein: ENSMUSP00000120988
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146516
AA Change: T125N

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119962
Gene: ENSMUSG00000035621
AA Change: T125N

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 88 112 N/A INTRINSIC
low complexity region 133 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151202
SMART Domains Protein: ENSMUSP00000115717
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
Blast:UBQ 32 67 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153477
SMART Domains Protein: ENSMUSP00000119787
Gene: ENSMUSG00000035621

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a protein that contains an ubiquitin-like domain. This protein may be involved in the regulation of brain development as inferred by its high expression level in the embryonic midbrain. This protein has been found to negatively regulate glucokinase activity and insulin secretion in pancreatic beta cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate and small ovary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Midn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Midn APN 10 80156643 unclassified probably benign
IGL01969:Midn APN 10 80155259 missense probably benign 0.00
IGL02824:Midn APN 10 80153652 missense possibly damaging 0.91
Midnight UTSW 10 80154457 missense probably damaging 0.98
Sepia UTSW 10 80151404 missense probably null 0.26
R0684:Midn UTSW 10 80156502 missense probably damaging 1.00
R1926:Midn UTSW 10 80151661 missense probably damaging 1.00
R2004:Midn UTSW 10 80155149 missense probably benign 0.13
R2016:Midn UTSW 10 80150115 missense possibly damaging 0.91
R2340:Midn UTSW 10 80150112 missense possibly damaging 0.66
R2483:Midn UTSW 10 80150310 missense probably benign 0.16
R3622:Midn UTSW 10 80150310 missense probably benign 0.16
R3624:Midn UTSW 10 80150310 missense probably benign 0.16
R4296:Midn UTSW 10 80151719 missense probably damaging 1.00
R4740:Midn UTSW 10 80151404 missense probably null 0.26
R4930:Midn UTSW 10 80155355 missense probably benign
R4977:Midn UTSW 10 80150184 missense probably damaging 1.00
R5423:Midn UTSW 10 80155193 missense probably benign 0.15
R6149:Midn UTSW 10 80154457 missense probably damaging 0.98
R6542:Midn UTSW 10 80156584 missense probably damaging 0.97
R6826:Midn UTSW 10 80154127 nonsense probably null
X0018:Midn UTSW 10 80153997 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CGAGTCGGGGATCACATGATGTTTG -3'
(R):5'- TCACGAAGCTCTCAATGACCGC -3'

Sequencing Primer
(F):5'- CACCGCCATGTGCTTGC -3'
(R):5'- GAGAACAGTCCATCTGCTGG -3'
Posted On2014-04-13