Incidental Mutation 'R1517:P4ha2'
ID167111
Institutional Source Beutler Lab
Gene Symbol P4ha2
Ensembl Gene ENSMUSG00000018906
Gene Nameprocollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
SynonymsP4hl
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54100095-54131665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54117645 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 226 (H226R)
Ref Sequence ENSEMBL: ENSMUSP00000133275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019050] [ENSMUST00000093107] [ENSMUST00000138477] [ENSMUST00000141258] [ENSMUST00000151218] [ENSMUST00000174616]
Predicted Effect probably benign
Transcript: ENSMUST00000019050
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000019050
Gene: ENSMUSG00000018906
AA Change: H226R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 28 159 2.6e-40 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
Blast:P4Hc 232 303 4e-13 BLAST
P4Hc 338 521 1.61e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093107
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091749
Gene: ENSMUSG00000018906
AA Change: H226R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125651
Predicted Effect probably benign
Transcript: ENSMUST00000138477
SMART Domains Protein: ENSMUSP00000121119
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 158 3.1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141258
Predicted Effect probably benign
Transcript: ENSMUST00000151218
SMART Domains Protein: ENSMUSP00000118384
Gene: ENSMUSG00000018906

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 128 6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155299
Predicted Effect probably benign
Transcript: ENSMUST00000174616
AA Change: H226R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133275
Gene: ENSMUSG00000018906
AA Change: H226R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:P4Ha_N 27 160 6.3e-44 PFAM
SCOP:d1qqea_ 171 258 1e-3 SMART
P4Hc 338 519 7.67e-65 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of prolyl 4-hydroxylase, a key enzyme in collagen synthesis composed of two identical alpha subunits and two beta subunits. The encoded protein is one of several different types of alpha subunits and provides the major part of the catalytic site of the active enzyme. In collagen and related proteins, prolyl 4-hydroxylase catalyzes the formation of 4-hydroxyproline that is essential to the proper three-dimensional folding of newly synthesized procollagen chains. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in P4ha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:P4ha2 APN 11 54119305 missense probably damaging 1.00
IGL01324:P4ha2 APN 11 54120158 missense probably damaging 0.99
IGL01953:P4ha2 APN 11 54114170 missense probably benign 0.07
IGL02053:P4ha2 APN 11 54117587 missense probably benign
FR4342:P4ha2 UTSW 11 54110251 small deletion probably benign
R0471:P4ha2 UTSW 11 54117608 missense possibly damaging 0.82
R0938:P4ha2 UTSW 11 54119322 missense possibly damaging 0.67
R1467:P4ha2 UTSW 11 54106410 intron probably benign
R1556:P4ha2 UTSW 11 54125010 missense probably damaging 0.98
R3498:P4ha2 UTSW 11 54119253 missense probably benign 0.28
R3916:P4ha2 UTSW 11 54126248 missense probably benign 0.07
R4853:P4ha2 UTSW 11 54120170 missense probably benign 0.01
R4932:P4ha2 UTSW 11 54125020 missense probably benign 0.05
R5020:P4ha2 UTSW 11 54131190 missense probably damaging 1.00
R5892:P4ha2 UTSW 11 54120188 missense probably damaging 1.00
R5975:P4ha2 UTSW 11 54126412 critical splice donor site probably null
R6632:P4ha2 UTSW 11 54117648 missense probably benign 0.07
R7023:P4ha2 UTSW 11 54131246 missense probably benign 0.01
R7068:P4ha2 UTSW 11 54110994 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGCTCAGCTTACAATGAAGGAGAC -3'
(R):5'- TGCATAGTGGTACAAGCACCACAAC -3'

Sequencing Primer
(F):5'- GGAGACTATTACCATACTGTGCTG -3'
(R):5'- AGTGTGTATAAGAAGCTACTCGGTG -3'
Posted On2014-04-13