Incidental Mutation 'R1517:Itga2b'
ID167116
Institutional Source Beutler Lab
Gene Symbol Itga2b
Ensembl Gene ENSMUSG00000034664
Gene Nameintegrin alpha 2b
Synonymsplatelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102453297-102470122 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 102466325 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 243 (L243*)
Ref Sequence ENSEMBL: ENSMUSP00000099375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103086]
Predicted Effect probably null
Transcript: ENSMUST00000103086
AA Change: L243*
SMART Domains Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664
AA Change: L243*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Int_alpha 46 103 2.34e-10 SMART
Int_alpha 261 311 1.3e-3 SMART
Int_alpha 315 376 4.9e-13 SMART
Int_alpha 382 438 4.34e-14 SMART
Int_alpha 443 494 4.05e-5 SMART
low complexity region 552 567 N/A INTRINSIC
SCOP:d1m1xa2 635 770 1e-48 SMART
SCOP:d1m1xa3 775 995 3e-66 SMART
Pfam:Integrin_alpha 1015 1029 5.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149519
Meta Mutation Damage Score 0.622 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Itga2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Itga2b APN 11 102455583 missense probably damaging 1.00
IGL02197:Itga2b APN 11 102466319 missense probably benign 0.19
IGL02349:Itga2b APN 11 102461363 missense probably damaging 0.98
IGL02711:Itga2b APN 11 102465725 missense possibly damaging 0.53
R0282:Itga2b UTSW 11 102460846 missense probably damaging 0.99
R0349:Itga2b UTSW 11 102467426 missense probably damaging 0.98
R0384:Itga2b UTSW 11 102465362 splice site probably null
R0403:Itga2b UTSW 11 102467326 critical splice donor site probably null
R0452:Itga2b UTSW 11 102465953 intron probably null
R0535:Itga2b UTSW 11 102457533 missense possibly damaging 0.65
R1412:Itga2b UTSW 11 102457005 missense probably benign 0.00
R1615:Itga2b UTSW 11 102460137 critical splice donor site probably null
R1716:Itga2b UTSW 11 102460777 missense probably benign 0.30
R1953:Itga2b UTSW 11 102458183 missense probably benign 0.18
R2001:Itga2b UTSW 11 102467339 missense probably benign
R2216:Itga2b UTSW 11 102467866 missense probably benign 0.35
R4193:Itga2b UTSW 11 102469685 missense probably benign 0.01
R4770:Itga2b UTSW 11 102460756 missense probably damaging 1.00
R4805:Itga2b UTSW 11 102467866 missense probably benign 0.00
R4880:Itga2b UTSW 11 102457722 intron probably benign
R4906:Itga2b UTSW 11 102461159 missense probably benign 0.43
R5112:Itga2b UTSW 11 102458191 missense probably damaging 0.99
R5362:Itga2b UTSW 11 102461135 missense probably damaging 0.99
R5739:Itga2b UTSW 11 102465909 missense probably benign 0.14
R5761:Itga2b UTSW 11 102466274 missense probably benign 0.00
R5840:Itga2b UTSW 11 102461331 missense probably damaging 1.00
R5851:Itga2b UTSW 11 102457601 intron probably benign
R6239:Itga2b UTSW 11 102465318 missense possibly damaging 0.61
R6491:Itga2b UTSW 11 102459869 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACTAGAATCCACAGCGAGAAGGG -3'
(R):5'- AATAGGAGAGACCGTCTCACGACC -3'

Sequencing Primer
(F):5'- CCAGTGTGGATGGGAAGTG -3'
(R):5'- ACGACCAGGACTTCTTTTTCAGG -3'
Posted On2014-04-13