Incidental Mutation 'R1517:Akap5'
ID167119
Institutional Source Beutler Lab
Gene Symbol Akap5
Ensembl Gene ENSMUSG00000021057
Gene NameA kinase (PRKA) anchor protein 5
SynonymsLOC238276, AKAP150, 3526401B18Rik
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76324891-76334153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76329262 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 489 (E489D)
Ref Sequence ENSEMBL: ENSMUSP00000134127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095610] [ENSMUST00000154078] [ENSMUST00000172992]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095610
AA Change: E489D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093270
Gene: ENSMUSG00000021057
AA Change: E489D

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:WSK 78 108 4.7e-13 PFAM
SCOP:d1k28a2 386 573 6e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154078
AA Change: E482D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114495
Gene: ENSMUSG00000021057
AA Change: E482D

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:WSK 71 101 3.3e-13 PFAM
SCOP:d1k28a2 379 566 8e-21 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172992
AA Change: E489D

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134127
Gene: ENSMUSG00000021057
AA Change: E489D

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
Pfam:WSK 79 107 8.7e-15 PFAM
SCOP:d1k28a2 386 573 6e-21 SMART
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein binds to the RII-beta regulatory subunit of PKA, and also to protein kinase C and the phosphatase calcineurin. It is predominantly expressed in cerebral cortex and may anchor the PKA protein at postsynaptic densities (PSD) and be involved in the regulation of postsynaptic events. It is also expressed in T lymphocytes and may function to inhibit interleukin-2 transcription by disrupting calcineurin-dependent dephosphorylation of NFAT. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced long term potentiation, improved glucose handling and heightened insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Adrb2 T C 18: 62,178,800 N318S probably damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Akap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02194:Akap5 APN 12 76328033 missense probably damaging 0.99
IGL02309:Akap5 APN 12 76328855 missense possibly damaging 0.91
IGL02801:Akap5 APN 12 76328995 missense probably benign 0.25
IGL03136:Akap5 APN 12 76329875 nonsense probably null
R1694:Akap5 UTSW 12 76329924 missense probably damaging 0.99
R2012:Akap5 UTSW 12 76329348 missense possibly damaging 0.53
R4507:Akap5 UTSW 12 76327907 missense possibly damaging 0.91
R4755:Akap5 UTSW 12 76327807 nonsense probably null
R4893:Akap5 UTSW 12 76329969 missense probably damaging 0.99
R4905:Akap5 UTSW 12 76328433 missense probably damaging 0.96
R5482:Akap5 UTSW 12 76328826 missense probably benign 0.26
R5886:Akap5 UTSW 12 76327845 missense possibly damaging 0.88
R7151:Akap5 UTSW 12 76328249 missense not run
X0067:Akap5 UTSW 12 76328198 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGTTGGTCAGGCAGAGGAAGC -3'
(R):5'- GATCTGGTGCATGGCTCGATATAGC -3'

Sequencing Primer
(F):5'- AGCTACAGTTGATCGGGC -3'
(R):5'- ATGGCTCGATATAGCTTCCTCAG -3'
Posted On2014-04-13