Incidental Mutation 'R1517:Adrb2'
ID167146
Institutional Source Beutler Lab
Gene Symbol Adrb2
Ensembl Gene ENSMUSG00000045730
Gene Nameadrenergic receptor, beta 2
SynonymsGpcr7, beta 2-AR, Adrb-2, beta 2-adrenoceptor, Badm
MMRRC Submission 039563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1517 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location62177817-62179959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62178800 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 318 (N318S)
Ref Sequence ENSEMBL: ENSMUSP00000062256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053640] [ENSMUST00000067743]
Predicted Effect probably damaging
Transcript: ENSMUST00000053640
AA Change: N318S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062256
Gene: ENSMUSG00000045730
AA Change: N318S

DomainStartEndE-ValueType
Pfam:7tm_4 40 246 4.7e-10 PFAM
Pfam:7TM_GPCR_Srx 41 250 2.2e-8 PFAM
Pfam:7TM_GPCR_Srsx 43 340 1.4e-15 PFAM
Pfam:7tm_1 50 326 9.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067743
SMART Domains Protein: ENSMUSP00000065944
Gene: ENSMUSG00000054589

DomainStartEndE-ValueType
low complexity region 53 69 N/A INTRINSIC
Meta Mutation Damage Score 0.4 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This intronless gene belongs to the G-protein-coupled receptor superfamily, which includes transmembrane proteins that play a role in signal transduction across biological membranes resulting in a variety of physiological responses. The encoded protein is a beta-2 adrenergic receptor which is activated by catecholamine ligands such as adrenaline and epinephrine. The protein participates in the classical signaling pathway involving G protein, adenylyl cyclase, cAMP (3'-5'-cyclic adenosine monophosphate) and protein kinase A (PKA). In humans, this gene is implicated in susceptibility to nocturnal asthma, obesity and type 2 diabetes. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene exhibit increased bone mass. The primary physiological consequences are seen during exercise stress and result from alterations in vascular tone and energy metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,971,814 K375R possibly damaging Het
Akap5 A C 12: 76,329,262 E489D possibly damaging Het
Aldh7a1 T A 18: 56,532,061 I385F probably damaging Het
Astn1 T A 1: 158,579,576 probably benign Het
Atp7b T A 8: 21,997,358 T1314S probably damaging Het
Bhmt2 C A 13: 93,662,339 G325C probably damaging Het
Brpf1 T A 6: 113,319,089 V781E probably benign Het
Cacna1c T A 6: 118,598,759 Y1860F probably benign Het
Ccdc7a T C 8: 129,061,681 T56A probably damaging Het
Cep78 A G 19: 15,959,663 S560P probably damaging Het
Cnot1 G A 8: 95,743,213 T1343I probably benign Het
Coq10b T C 1: 55,064,257 S65P probably damaging Het
Creld1 T A 6: 113,489,784 C243S probably damaging Het
Cst12 A T 2: 148,793,252 I121F possibly damaging Het
Cyp26a1 A C 19: 37,698,860 E165A probably benign Het
Cyp2d12 T G 15: 82,558,136 M273R probably damaging Het
Dnajb7 T A 15: 81,407,456 S227C probably damaging Het
Evc T A 5: 37,319,035 Q390L probably damaging Het
F830016B08Rik T A 18: 60,300,898 L351* probably null Het
Fga T C 3: 83,031,838 S507P probably benign Het
Gba A T 3: 89,206,148 Y239F probably damaging Het
Golga2 C A 2: 32,305,984 Y843* probably null Het
Gria4 C A 9: 4,793,865 L64F probably damaging Het
Hectd3 A G 4: 117,002,994 Y803C probably damaging Het
Hmcn1 T C 1: 150,669,421 K2812E probably damaging Het
Il17b T G 18: 61,690,245 V50G probably damaging Het
Itga2b A T 11: 102,466,325 L243* probably null Het
Kank4 C A 4: 98,779,029 V394L possibly damaging Het
Kat14 T A 2: 144,373,791 D65E probably benign Het
Kcnh3 T C 15: 99,238,209 Y696H probably damaging Het
Kctd19 C A 8: 105,395,376 D180Y probably damaging Het
Klra8 A C 6: 130,115,640 S233A probably benign Het
Masp2 A T 4: 148,612,106 T387S possibly damaging Het
Midn C A 10: 80,154,123 T275N probably damaging Het
Mis18bp1 A G 12: 65,133,813 F965L probably benign Het
Myo3a G T 2: 22,282,634 V186L probably damaging Het
Ncoa2 T A 1: 13,165,057 N884I probably benign Het
Olfr1082 T A 2: 86,594,604 T75S probably damaging Het
Olfr272 A T 4: 52,911,502 C97* probably null Het
Olfr963 T C 9: 39,669,720 I221T probably damaging Het
Osr2 T C 15: 35,300,667 V123A probably benign Het
P4ha2 A G 11: 54,117,645 H226R probably benign Het
Pcdhb16 T A 18: 37,478,098 V37E probably benign Het
Pcdhb18 T A 18: 37,489,620 M1K probably null Het
Pcsk1 T A 13: 75,098,047 Y181* probably null Het
Pros1 G T 16: 62,885,512 C63F probably damaging Het
Ranbp3l T A 15: 9,065,001 C353* probably null Het
Rev3l T C 10: 39,838,443 Y2388H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rpl12-ps1 G T 1: 36,958,377 noncoding transcript Het
Rttn T C 18: 89,113,350 V1951A probably benign Het
Scn9a G A 2: 66,505,027 probably benign Het
Sdk1 T C 5: 142,127,836 F1546S probably damaging Het
Sh3glb2 C T 2: 30,354,975 R71Q probably damaging Het
Slc30a6 T C 17: 74,408,847 F101L probably benign Het
Snrpd1 T C 18: 10,626,913 I60T probably damaging Het
Sox10 T A 15: 79,159,178 E218D probably benign Het
Tekt3 C A 11: 63,070,490 H162N probably damaging Het
Tnfsf13 T C 11: 69,684,738 S246G possibly damaging Het
Trim10 T A 17: 36,872,454 I214N probably damaging Het
Trp63 C A 16: 25,889,253 D566E probably damaging Het
Uck2 T C 1: 167,234,724 D156G probably damaging Het
Zfp386 T A 12: 116,059,605 S314R possibly damaging Het
Zfp467 C T 6: 48,438,236 R494H probably damaging Het
Zfp735 A T 11: 73,710,644 D138V probably benign Het
Zfyve26 T C 12: 79,252,151 E445G probably damaging Het
Other mutations in Adrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02336:Adrb2 APN 18 62179007 missense probably benign 0.00
R0091:Adrb2 UTSW 18 62179019 missense probably benign
R0420:Adrb2 UTSW 18 62179539 missense possibly damaging 0.76
R0436:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
R0604:Adrb2 UTSW 18 62178515 missense possibly damaging 0.49
R0626:Adrb2 UTSW 18 62179370 missense probably damaging 1.00
R0843:Adrb2 UTSW 18 62179071 missense probably benign 0.03
R0940:Adrb2 UTSW 18 62179691 missense probably benign 0.00
R1498:Adrb2 UTSW 18 62178933 missense probably damaging 1.00
R1603:Adrb2 UTSW 18 62179508 missense probably damaging 1.00
R1944:Adrb2 UTSW 18 62179413 missense probably damaging 1.00
R4367:Adrb2 UTSW 18 62179056 missense probably damaging 1.00
R5143:Adrb2 UTSW 18 62178776 missense probably damaging 1.00
R5468:Adrb2 UTSW 18 62179625 missense probably damaging 1.00
R5644:Adrb2 UTSW 18 62178682 missense probably benign 0.01
R6073:Adrb2 UTSW 18 62179466 missense probably benign 0.01
R6753:Adrb2 UTSW 18 62179553 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACCTTGACAGTTCACAAAGCCTTCC -3'
(R):5'- GTTCTGCTTGAAAGAGCACAAAGCC -3'

Sequencing Primer
(F):5'- AAAGCCTTCCATGCCTGG -3'
(R):5'- GCCCTCAAGACTTTAGGCATC -3'
Posted On2014-04-13