Incidental Mutation 'R1518:Cacna1s'
ID167151
Institutional Source Beutler Lab
Gene Symbol Cacna1s
Ensembl Gene ENSMUSG00000026407
Gene Namecalcium channel, voltage-dependent, L type, alpha 1S subunit
Synonymssj, mdg, muscle dysgenesis, DHPR alpha1s, Cav1.1, Cchl1a3, fmd
Accession Numbers

Genbank: NM_001081023; MGI: 88294

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1518 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136052750-136119822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 136098551 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1092 (A1092V)
Ref Sequence ENSEMBL: ENSMUSP00000125278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112064] [ENSMUST00000112068] [ENSMUST00000160641] [ENSMUST00000161865]
Predicted Effect probably damaging
Transcript: ENSMUST00000112064
AA Change: A1092V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107695
Gene: ENSMUSG00000026407
AA Change: A1092V

DomainStartEndE-ValueType
Pfam:Ion_trans 50 345 4.3e-68 PFAM
Pfam:Ion_trans 431 672 4.5e-56 PFAM
Pfam:PKD_channel 516 667 1.9e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
Pfam:Ion_trans 798 1076 2.6e-65 PFAM
Pfam:Ion_trans 1117 1392 1.2e-71 PFAM
Pfam:PKD_channel 1126 1387 8.4e-13 PFAM
Pfam:GPHH 1394 1463 2.3e-38 PFAM
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Pfam:CAC1F_C 1756 1845 2.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112068
AA Change: A1092V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107699
Gene: ENSMUSG00000026407
AA Change: A1092V

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.1e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.7e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 3.9e-53 PFAM
Pfam:Ion_trans 1152 1361 6.7e-66 PFAM
Pfam:PKD_channel 1201 1368 8.4e-10 PFAM
Blast:EFh 1382 1410 5e-8 BLAST
Ca_chan_IQ 1496 1529 3.71e-14 SMART
low complexity region 1638 1650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160641
AA Change: A1092V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125278
Gene: ENSMUSG00000026407
AA Change: A1092V

DomainStartEndE-ValueType
Pfam:Ion_trans 88 333 9.3e-57 PFAM
PDB:4DEY|B 334 417 1e-20 PDB
Pfam:Ion_trans 466 660 3.8e-46 PFAM
Pfam:PKD_channel 513 667 6.7e-7 PFAM
low complexity region 675 685 N/A INTRINSIC
low complexity region 740 756 N/A INTRINSIC
low complexity region 804 818 N/A INTRINSIC
Pfam:Ion_trans 834 1064 4e-53 PFAM
Pfam:PKD_channel 1126 1387 6.1e-12 PFAM
Pfam:Ion_trans 1152 1380 9e-65 PFAM
Blast:EFh 1401 1429 5e-8 BLAST
Ca_chan_IQ 1515 1548 3.71e-14 SMART
low complexity region 1657 1669 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161865
AA Change: A845V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125262
Gene: ENSMUSG00000026407
AA Change: A845V

DomainStartEndE-ValueType
Pfam:Ion_trans 3 98 1.1e-21 PFAM
Pfam:Ion_trans 184 425 3.3e-56 PFAM
Pfam:PKD_channel 267 420 1.8e-7 PFAM
low complexity region 428 438 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
Pfam:Ion_trans 551 829 1.9e-65 PFAM
Pfam:Ion_trans 870 1126 5.4e-72 PFAM
Pfam:PKD_channel 954 1121 7.2e-10 PFAM
Pfam:GPHH 1128 1197 1.8e-38 PFAM
Ca_chan_IQ 1249 1282 3.71e-14 SMART
low complexity region 1391 1403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype Strain: 1856326
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the five subunits of the slowly inactivating L-type voltage-dependent calcium channel in skeletal muscle cells. Mutations in this gene have been associated with hypokalemic periodic paralysis, thyrotoxic periodic paralysis and malignant hyperthermia susceptibility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show edema and failure of myoblast differentiation by day 13 of embryonic development and die perinatally. All muscles degenerate and additional secondary anomalies of the skeleton, short jaw, and cleft palate are seen. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Spontaneous(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,275,369 M493L probably benign Het
Abtb2 G A 2: 103,709,284 V665I probably benign Het
Adamtsl1 C G 4: 86,342,603 S1017W probably damaging Het
Aebp1 A G 11: 5,871,469 T623A possibly damaging Het
Alox5 A G 6: 116,413,780 F470S probably damaging Het
Angpt2 T C 8: 18,705,839 E204G probably benign Het
Apip A G 2: 103,089,493 E138G probably damaging Het
Apob C T 12: 7,989,207 T466M probably benign Het
Atp2b3 GACAACA GACA X: 73,545,123 probably benign Het
Atxn7l3 A T 11: 102,294,514 D56E probably benign Het
Calr3 A G 8: 72,427,200 F183L probably damaging Het
Cd300lb T A 11: 114,926,051 D55V probably benign Het
Chid1 A C 7: 141,528,471 V145G probably damaging Het
Chst15 T C 7: 132,270,126 N142S probably damaging Het
Cnot4 C T 6: 35,051,454 R409Q probably damaging Het
Cope T G 8: 70,312,761 I287S possibly damaging Het
Cpd A T 11: 76,840,386 probably null Het
Cux1 G T 5: 136,308,279 T785K probably benign Het
Dthd1 T C 5: 62,822,040 S348P probably damaging Het
Eno3 G T 11: 70,661,077 E64* probably null Het
Entpd1 T A 19: 40,725,063 Y184* probably null Het
Erv3 A T 2: 131,856,163 M92K probably benign Het
Flg2 T A 3: 93,203,138 H824Q unknown Het
Fndc9 G A 11: 46,238,103 G150S probably benign Het
Gdap1 G A 1: 17,146,945 V43I possibly damaging Het
Ifi213 C A 1: 173,589,663 L394F probably damaging Het
Ift88 A G 14: 57,430,628 T29A possibly damaging Het
Kdm4c A T 4: 74,333,826 I437L probably benign Het
Kras T A 6: 145,232,251 E98D probably benign Het
Lcorl C A 5: 45,734,201 R353I possibly damaging Het
Lrrc4c A G 2: 97,630,576 I516V probably benign Het
Lrrc51 T C 7: 101,915,596 D85G probably damaging Het
Lypd6b G A 2: 49,947,492 A159T probably damaging Het
Magel2 G A 7: 62,380,440 V1031I unknown Het
Man1c1 A T 4: 134,580,789 N338K probably benign Het
Mdn1 C A 4: 32,739,977 Q3744K probably damaging Het
Micu3 G T 8: 40,335,852 A135S possibly damaging Het
Muc4 T C 16: 32,750,349 S76P possibly damaging Het
Nin T G 12: 70,014,773 T2106P probably benign Het
Nlrp4e T C 7: 23,321,843 I585T probably benign Het
Npy1r C T 8: 66,704,195 A89V probably benign Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr1220 G A 2: 89,097,600 A109V probably benign Het
Olfr608 T A 7: 103,470,042 M1K probably null Het
Olfr665 T A 7: 104,881,308 Y200* probably null Het
Olfr743 T C 14: 50,534,165 V251A probably damaging Het
Parp14 T G 16: 35,856,638 T987P possibly damaging Het
Pde7b A T 10: 20,548,121 V3E probably damaging Het
Pdlim7 G T 13: 55,508,294 Y104* probably null Het
Pgm2l1 A G 7: 100,261,725 K292R probably benign Het
Plec T C 15: 76,188,201 E728G probably damaging Het
Plppr4 T C 3: 117,335,503 Y105C probably damaging Het
Polr1c A T 17: 46,247,895 N23K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prkca T C 11: 107,978,316 D57G probably damaging Het
Prkcb A G 7: 122,544,631 probably null Het
Prl6a1 C A 13: 27,318,927 Q169K possibly damaging Het
Prl6a1 A T 13: 27,318,928 Q169L probably null Het
Psmd14 G A 2: 61,760,991 R46H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ramp2 A G 11: 101,247,582 T22A probably benign Het
Rbm19 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 5: 120,140,280 probably benign Het
Rbm25 A T 12: 83,668,445 E463D possibly damaging Het
Retnlb A G 16: 48,817,315 I35V probably benign Het
Sestd1 A G 2: 77,241,632 Y49H probably damaging Het
Setd2 T A 9: 110,602,238 I2378N probably damaging Het
Slc26a1 A T 5: 108,671,874 C486* probably null Het
Spef2 T A 15: 9,667,230 I791F probably damaging Het
Sptb T C 12: 76,604,024 T1726A possibly damaging Het
St5 A G 7: 109,557,355 S63P probably damaging Het
Stk38l T A 6: 146,771,631 M296K probably benign Het
Taf5 T C 19: 47,081,846 F624L probably damaging Het
Tmem30c G T 16: 57,266,492 T316K probably damaging Het
Trpm2 A G 10: 77,943,005 S376P possibly damaging Het
Vmn2r82 A T 10: 79,378,868 L228F probably damaging Het
Zfp607b G A 7: 27,698,662 C57Y possibly damaging Het
Zfp983 A G 17: 21,662,353 H399R probably damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Cacna1s
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Cacna1s APN 1 136084273 nonsense probably null
IGL00517:Cacna1s APN 1 136087339 missense probably damaging 1.00
IGL01316:Cacna1s APN 1 136118964 missense probably benign 0.01
IGL01348:Cacna1s APN 1 136075152 missense possibly damaging 0.95
IGL01739:Cacna1s APN 1 136097132 critical splice donor site probably null
IGL01773:Cacna1s APN 1 136118753 missense probably benign 0.32
IGL02056:Cacna1s APN 1 136119000 missense probably benign
IGL02262:Cacna1s APN 1 136108129 missense probably damaging 0.98
IGL02324:Cacna1s APN 1 136075176 splice site probably benign
IGL02352:Cacna1s APN 1 136093252 splice site probably benign
IGL02359:Cacna1s APN 1 136093252 splice site probably benign
IGL02370:Cacna1s APN 1 136085347 missense probably damaging 1.00
IGL02377:Cacna1s APN 1 136068994 missense probably damaging 1.00
IGL02474:Cacna1s APN 1 136118380 missense probably benign
IGL02606:Cacna1s APN 1 136079519 missense probably damaging 0.99
IGL02833:Cacna1s APN 1 136071005 missense probably benign 0.03
IGL02974:Cacna1s APN 1 136092617 missense possibly damaging 0.78
IGL03064:Cacna1s APN 1 136111993 missense probably damaging 1.00
IGL03093:Cacna1s APN 1 136116064 missense probably benign 0.00
IGL03286:Cacna1s APN 1 136077659 missense probably benign
N/A:Cacna1s UTSW 1 136073509 missense probably benign 0.00
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0030:Cacna1s UTSW 1 136094989 critical splice donor site probably null
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0097:Cacna1s UTSW 1 136100622 missense possibly damaging 0.79
R0240:Cacna1s UTSW 1 136073496 unclassified probably benign
R0255:Cacna1s UTSW 1 136118806 missense possibly damaging 0.93
R0302:Cacna1s UTSW 1 136100604 missense probably benign 0.01
R0319:Cacna1s UTSW 1 136070717 missense probably damaging 0.99
R0411:Cacna1s UTSW 1 136113303 missense probably damaging 1.00
R0413:Cacna1s UTSW 1 136098209 missense probably benign 0.00
R0482:Cacna1s UTSW 1 136113394 missense probably benign
R0491:Cacna1s UTSW 1 136089008 splice site probably benign
R0518:Cacna1s UTSW 1 136076859 missense probably benign
R0717:Cacna1s UTSW 1 136098291 missense probably damaging 1.00
R0725:Cacna1s UTSW 1 136098526 splice site probably benign
R0815:Cacna1s UTSW 1 136112957 missense possibly damaging 0.95
R1384:Cacna1s UTSW 1 136094971 missense probably benign 0.02
R1548:Cacna1s UTSW 1 136110937 missense probably damaging 1.00
R1725:Cacna1s UTSW 1 136098623 missense probably damaging 1.00
R1728:Cacna1s UTSW 1 136118716 missense probably benign
R1729:Cacna1s UTSW 1 136118716 missense probably benign
R1730:Cacna1s UTSW 1 136118716 missense probably benign
R1739:Cacna1s UTSW 1 136118716 missense probably benign
R1762:Cacna1s UTSW 1 136118716 missense probably benign
R1783:Cacna1s UTSW 1 136118716 missense probably benign
R1784:Cacna1s UTSW 1 136118716 missense probably benign
R1785:Cacna1s UTSW 1 136118716 missense probably benign
R1800:Cacna1s UTSW 1 136076854 missense probably benign
R1924:Cacna1s UTSW 1 136089017 splice site probably null
R1969:Cacna1s UTSW 1 136119095 missense probably benign 0.42
R2072:Cacna1s UTSW 1 136079504 missense probably benign
R2380:Cacna1s UTSW 1 136095848 missense probably damaging 1.00
R3110:Cacna1s UTSW 1 136075093 nonsense probably null
R3112:Cacna1s UTSW 1 136075093 nonsense probably null
R3151:Cacna1s UTSW 1 136105794 missense probably damaging 1.00
R3696:Cacna1s UTSW 1 136105814 missense probably damaging 1.00
R3722:Cacna1s UTSW 1 136069042 missense possibly damaging 0.77
R3804:Cacna1s UTSW 1 136107018 missense possibly damaging 0.85
R3813:Cacna1s UTSW 1 136085347 missense probably damaging 1.00
R3905:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3907:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R3909:Cacna1s UTSW 1 136084269 missense probably damaging 0.99
R4170:Cacna1s UTSW 1 136108195 missense probably damaging 1.00
R4329:Cacna1s UTSW 1 136119033 missense probably benign 0.00
R4485:Cacna1s UTSW 1 136076852 missense probably damaging 1.00
R4581:Cacna1s UTSW 1 136070970 unclassified probably null
R4719:Cacna1s UTSW 1 136118652 splice site probably benign
R4816:Cacna1s UTSW 1 136115269 missense possibly damaging 0.89
R4909:Cacna1s UTSW 1 136079604 missense probably damaging 0.99
R4917:Cacna1s UTSW 1 136101564 critical splice donor site probably null
R5296:Cacna1s UTSW 1 136095785 missense probably benign 0.11
R5411:Cacna1s UTSW 1 136105811 missense probably benign 0.09
R5503:Cacna1s UTSW 1 136086742 missense probably damaging 1.00
R5533:Cacna1s UTSW 1 136098375 critical splice donor site probably null
R5714:Cacna1s UTSW 1 136112066 missense probably benign 0.44
R5775:Cacna1s UTSW 1 136108122 missense probably damaging 1.00
R5814:Cacna1s UTSW 1 136107142 missense probably benign 0.31
R5820:Cacna1s UTSW 1 136079604 missense probably damaging 1.00
R5822:Cacna1s UTSW 1 136112078 missense probably damaging 1.00
R5877:Cacna1s UTSW 1 136100667 missense probably damaging 0.99
R5923:Cacna1s UTSW 1 136076822 missense possibly damaging 0.79
R6021:Cacna1s UTSW 1 136106487 missense probably benign 0.15
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6037:Cacna1s UTSW 1 136070967 missense possibly damaging 0.90
R6056:Cacna1s UTSW 1 136105836 missense probably damaging 1.00
R6143:Cacna1s UTSW 1 136076758 missense probably damaging 0.99
R6222:Cacna1s UTSW 1 136104622 missense probably benign 0.00
R6237:Cacna1s UTSW 1 136105844 missense possibly damaging 0.88
R6274:Cacna1s UTSW 1 136089045 missense probably benign 0.02
R6609:Cacna1s UTSW 1 136113391 missense probably benign 0.30
R6626:Cacna1s UTSW 1 136094965 missense probably damaging 1.00
R6838:Cacna1s UTSW 1 136084437 missense possibly damaging 0.91
R6848:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6849:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6850:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6851:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6868:Cacna1s UTSW 1 136092694 missense probably benign 0.01
R6879:Cacna1s UTSW 1 136115959 missense probably benign 0.12
R6893:Cacna1s UTSW 1 136077693 missense probably benign 0.05
X0025:Cacna1s UTSW 1 136115970 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACCTTCCAGGAACAGGGAGAGAC -3'
(R):5'- ACGAGGAGGCTGAGGTTAGTTCAC -3'

Sequencing Primer
(F):5'- cgacaagaaccaggtactgag -3'
(R):5'- GAACTGGGGACTTCTCTCTGTC -3'
Posted On2014-04-13