Incidental Mutation 'R1518:Kdm4c'
ID167165
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Possibly non essential (E-score: 0.443) question?
Stock #R1518 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74333826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 437 (I437L)
Ref Sequence ENSEMBL: ENSMUSP00000077017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851] [ENSMUST00000149295]
Predicted Effect probably benign
Transcript: ENSMUST00000030102
AA Change: I437L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: I437L

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077851
AA Change: I437L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: I437L

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149295
SMART Domains Protein: ENSMUSP00000118728
Gene: ENSMUSG00000028397

DomainStartEndE-ValueType
Pfam:JmjN 17 49 9.4e-14 PFAM
low complexity region 102 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156065
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,275,369 M493L probably benign Het
Abtb2 G A 2: 103,709,284 V665I probably benign Het
Adamtsl1 C G 4: 86,342,603 S1017W probably damaging Het
Aebp1 A G 11: 5,871,469 T623A possibly damaging Het
Alox5 A G 6: 116,413,780 F470S probably damaging Het
Angpt2 T C 8: 18,705,839 E204G probably benign Het
Apip A G 2: 103,089,493 E138G probably damaging Het
Apob C T 12: 7,989,207 T466M probably benign Het
Atp2b3 GACAACA GACA X: 73,545,123 probably benign Het
Atxn7l3 A T 11: 102,294,514 D56E probably benign Het
Cacna1s C T 1: 136,098,551 A1092V probably damaging Het
Calr3 A G 8: 72,427,200 F183L probably damaging Het
Cd300lb T A 11: 114,926,051 D55V probably benign Het
Chid1 A C 7: 141,528,471 V145G probably damaging Het
Chst15 T C 7: 132,270,126 N142S probably damaging Het
Cnot4 C T 6: 35,051,454 R409Q probably damaging Het
Cope T G 8: 70,312,761 I287S possibly damaging Het
Cpd A T 11: 76,840,386 probably null Het
Cux1 G T 5: 136,308,279 T785K probably benign Het
Dthd1 T C 5: 62,822,040 S348P probably damaging Het
Eno3 G T 11: 70,661,077 E64* probably null Het
Entpd1 T A 19: 40,725,063 Y184* probably null Het
Erv3 A T 2: 131,856,163 M92K probably benign Het
Flg2 T A 3: 93,203,138 H824Q unknown Het
Fndc9 G A 11: 46,238,103 G150S probably benign Het
Gdap1 G A 1: 17,146,945 V43I possibly damaging Het
Ifi213 C A 1: 173,589,663 L394F probably damaging Het
Ift88 A G 14: 57,430,628 T29A possibly damaging Het
Kras T A 6: 145,232,251 E98D probably benign Het
Lcorl C A 5: 45,734,201 R353I possibly damaging Het
Lrrc4c A G 2: 97,630,576 I516V probably benign Het
Lrrc51 T C 7: 101,915,596 D85G probably damaging Het
Lypd6b G A 2: 49,947,492 A159T probably damaging Het
Magel2 G A 7: 62,380,440 V1031I unknown Het
Man1c1 A T 4: 134,580,789 N338K probably benign Het
Mdn1 C A 4: 32,739,977 Q3744K probably damaging Het
Micu3 G T 8: 40,335,852 A135S possibly damaging Het
Muc4 T C 16: 32,750,349 S76P possibly damaging Het
Nin T G 12: 70,014,773 T2106P probably benign Het
Nlrp4e T C 7: 23,321,843 I585T probably benign Het
Npy1r C T 8: 66,704,195 A89V probably benign Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr1220 G A 2: 89,097,600 A109V probably benign Het
Olfr608 T A 7: 103,470,042 M1K probably null Het
Olfr665 T A 7: 104,881,308 Y200* probably null Het
Olfr743 T C 14: 50,534,165 V251A probably damaging Het
Parp14 T G 16: 35,856,638 T987P possibly damaging Het
Pde7b A T 10: 20,548,121 V3E probably damaging Het
Pdlim7 G T 13: 55,508,294 Y104* probably null Het
Pgm2l1 A G 7: 100,261,725 K292R probably benign Het
Plec T C 15: 76,188,201 E728G probably damaging Het
Plppr4 T C 3: 117,335,503 Y105C probably damaging Het
Polr1c A T 17: 46,247,895 N23K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prkca T C 11: 107,978,316 D57G probably damaging Het
Prkcb A G 7: 122,544,631 probably null Het
Prl6a1 C A 13: 27,318,927 Q169K possibly damaging Het
Prl6a1 A T 13: 27,318,928 Q169L probably null Het
Psmd14 G A 2: 61,760,991 R46H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ramp2 A G 11: 101,247,582 T22A probably benign Het
Rbm19 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 5: 120,140,280 probably benign Het
Rbm25 A T 12: 83,668,445 E463D possibly damaging Het
Retnlb A G 16: 48,817,315 I35V probably benign Het
Sestd1 A G 2: 77,241,632 Y49H probably damaging Het
Setd2 T A 9: 110,602,238 I2378N probably damaging Het
Slc26a1 A T 5: 108,671,874 C486* probably null Het
Spef2 T A 15: 9,667,230 I791F probably damaging Het
Sptb T C 12: 76,604,024 T1726A possibly damaging Het
St5 A G 7: 109,557,355 S63P probably damaging Het
Stk38l T A 6: 146,771,631 M296K probably benign Het
Taf5 T C 19: 47,081,846 F624L probably damaging Het
Tmem30c G T 16: 57,266,492 T316K probably damaging Het
Trpm2 A G 10: 77,943,005 S376P possibly damaging Het
Vmn2r82 A T 10: 79,378,868 L228F probably damaging Het
Zfp607b G A 7: 27,698,662 C57Y possibly damaging Het
Zfp983 A G 17: 21,662,353 H399R probably damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1927:Kdm4c UTSW 4 74345483 missense probably benign 0.00
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2389:Kdm4c UTSW 4 74333870 critical splice donor site probably null
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5775:Kdm4c UTSW 4 74359431 missense probably damaging 1.00
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6491:Kdm4c UTSW 4 74373636 missense probably damaging 1.00
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCAGCATCCTGCTTTTAATAGCTT -3'
(R):5'- GTGTAGCATTCACTTTCCTCACAGGT -3'

Sequencing Primer
(F):5'- CCTGCTTTTAATAGCTTACAGGG -3'
(R):5'- TCCTCACAGGTAAATCATCTGTAAG -3'
Posted On2014-04-13