Incidental Mutation 'R1518:Alox5'
ID167177
Institutional Source Beutler Lab
Gene Symbol Alox5
Ensembl Gene ENSMUSG00000025701
Gene Namearachidonate 5-lipoxygenase
Synonyms5LO, 5-LOX, 5LX
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R1518 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116410077-116461178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116413780 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 470 (F470S)
Ref Sequence ENSEMBL: ENSMUSP00000130780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000079012] [ENSMUST00000101032] [ENSMUST00000164547] [ENSMUST00000170186] [ENSMUST00000203193] [ENSMUST00000203722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026795
AA Change: F470S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: F470S

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 212 662 1.5e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079012
SMART Domains Protein: ENSMUSP00000078024
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101032
SMART Domains Protein: ENSMUSP00000098594
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 47 64 N/A INTRINSIC
RINGv 75 123 1.16e-23 SMART
transmembrane domain 151 173 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164547
AA Change: F470S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: F470S

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 125 217 5.1e-12 PFAM
Pfam:Lipoxygenase 213 564 8.4e-133 PFAM
Pfam:Lipoxygenase 558 609 7.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167585
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169625
Predicted Effect possibly damaging
Transcript: ENSMUST00000170186
AA Change: F438S

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701
AA Change: F438S

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 150 220 1.9e-13 PFAM
Pfam:Lipoxygenase 215 432 8.6e-79 PFAM
Pfam:Lipoxygenase 426 634 1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203193
SMART Domains Protein: ENSMUSP00000145137
Gene: ENSMUSG00000025702

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
RINGv 36 84 2.9e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203722
SMART Domains Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701

DomainStartEndE-ValueType
LH2 2 115 2.2e-41 SMART
Pfam:Lipoxygenase 213 430 3e-35 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,275,369 M493L probably benign Het
Abtb2 G A 2: 103,709,284 V665I probably benign Het
Adamtsl1 C G 4: 86,342,603 S1017W probably damaging Het
Aebp1 A G 11: 5,871,469 T623A possibly damaging Het
Angpt2 T C 8: 18,705,839 E204G probably benign Het
Apip A G 2: 103,089,493 E138G probably damaging Het
Apob C T 12: 7,989,207 T466M probably benign Het
Atp2b3 GACAACA GACA X: 73,545,123 probably benign Het
Atxn7l3 A T 11: 102,294,514 D56E probably benign Het
Cacna1s C T 1: 136,098,551 A1092V probably damaging Het
Calr3 A G 8: 72,427,200 F183L probably damaging Het
Cd300lb T A 11: 114,926,051 D55V probably benign Het
Chid1 A C 7: 141,528,471 V145G probably damaging Het
Chst15 T C 7: 132,270,126 N142S probably damaging Het
Cnot4 C T 6: 35,051,454 R409Q probably damaging Het
Cope T G 8: 70,312,761 I287S possibly damaging Het
Cpd A T 11: 76,840,386 probably null Het
Cux1 G T 5: 136,308,279 T785K probably benign Het
Dthd1 T C 5: 62,822,040 S348P probably damaging Het
Eno3 G T 11: 70,661,077 E64* probably null Het
Entpd1 T A 19: 40,725,063 Y184* probably null Het
Erv3 A T 2: 131,856,163 M92K probably benign Het
Flg2 T A 3: 93,203,138 H824Q unknown Het
Fndc9 G A 11: 46,238,103 G150S probably benign Het
Gdap1 G A 1: 17,146,945 V43I possibly damaging Het
Ifi213 C A 1: 173,589,663 L394F probably damaging Het
Ift88 A G 14: 57,430,628 T29A possibly damaging Het
Kdm4c A T 4: 74,333,826 I437L probably benign Het
Kras T A 6: 145,232,251 E98D probably benign Het
Lcorl C A 5: 45,734,201 R353I possibly damaging Het
Lrrc4c A G 2: 97,630,576 I516V probably benign Het
Lrrc51 T C 7: 101,915,596 D85G probably damaging Het
Lypd6b G A 2: 49,947,492 A159T probably damaging Het
Magel2 G A 7: 62,380,440 V1031I unknown Het
Man1c1 A T 4: 134,580,789 N338K probably benign Het
Mdn1 C A 4: 32,739,977 Q3744K probably damaging Het
Micu3 G T 8: 40,335,852 A135S possibly damaging Het
Muc4 T C 16: 32,750,349 S76P possibly damaging Het
Nin T G 12: 70,014,773 T2106P probably benign Het
Nlrp4e T C 7: 23,321,843 I585T probably benign Het
Npy1r C T 8: 66,704,195 A89V probably benign Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr1220 G A 2: 89,097,600 A109V probably benign Het
Olfr608 T A 7: 103,470,042 M1K probably null Het
Olfr665 T A 7: 104,881,308 Y200* probably null Het
Olfr743 T C 14: 50,534,165 V251A probably damaging Het
Parp14 T G 16: 35,856,638 T987P possibly damaging Het
Pde7b A T 10: 20,548,121 V3E probably damaging Het
Pdlim7 G T 13: 55,508,294 Y104* probably null Het
Pgm2l1 A G 7: 100,261,725 K292R probably benign Het
Plec T C 15: 76,188,201 E728G probably damaging Het
Plppr4 T C 3: 117,335,503 Y105C probably damaging Het
Polr1c A T 17: 46,247,895 N23K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prkca T C 11: 107,978,316 D57G probably damaging Het
Prkcb A G 7: 122,544,631 probably null Het
Prl6a1 C A 13: 27,318,927 Q169K possibly damaging Het
Prl6a1 A T 13: 27,318,928 Q169L probably null Het
Psmd14 G A 2: 61,760,991 R46H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ramp2 A G 11: 101,247,582 T22A probably benign Het
Rbm19 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 5: 120,140,280 probably benign Het
Rbm25 A T 12: 83,668,445 E463D possibly damaging Het
Retnlb A G 16: 48,817,315 I35V probably benign Het
Sestd1 A G 2: 77,241,632 Y49H probably damaging Het
Setd2 T A 9: 110,602,238 I2378N probably damaging Het
Slc26a1 A T 5: 108,671,874 C486* probably null Het
Spef2 T A 15: 9,667,230 I791F probably damaging Het
Sptb T C 12: 76,604,024 T1726A possibly damaging Het
St5 A G 7: 109,557,355 S63P probably damaging Het
Stk38l T A 6: 146,771,631 M296K probably benign Het
Taf5 T C 19: 47,081,846 F624L probably damaging Het
Tmem30c G T 16: 57,266,492 T316K probably damaging Het
Trpm2 A G 10: 77,943,005 S376P possibly damaging Het
Vmn2r82 A T 10: 79,378,868 L228F probably damaging Het
Zfp607b G A 7: 27,698,662 C57Y possibly damaging Het
Zfp983 A G 17: 21,662,353 H399R probably damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Alox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Alox5 APN 6 116415517 missense probably damaging 1.00
IGL00954:Alox5 APN 6 116454299 missense probably damaging 1.00
IGL01610:Alox5 APN 6 116413547 missense probably damaging 1.00
IGL02161:Alox5 APN 6 116423193 missense probably benign 0.31
IGL02653:Alox5 APN 6 116415477 missense probably benign 0.41
IGL02903:Alox5 APN 6 116420335 missense probably damaging 1.00
clanger UTSW 6 116414595 missense probably damaging 1.00
triangle UTSW 6 116427137 splice site probably null
R0265:Alox5 UTSW 6 116420362 missense probably benign 0.04
R0347:Alox5 UTSW 6 116413552 missense possibly damaging 0.88
R0543:Alox5 UTSW 6 116454317 critical splice acceptor site probably null
R0633:Alox5 UTSW 6 116420384 missense probably damaging 1.00
R0656:Alox5 UTSW 6 116423330 splice site probably benign
R1298:Alox5 UTSW 6 116427264 missense probably damaging 1.00
R1416:Alox5 UTSW 6 116423145 nonsense probably null
R1484:Alox5 UTSW 6 116454167 missense probably damaging 1.00
R1485:Alox5 UTSW 6 116424164 missense probably damaging 1.00
R1993:Alox5 UTSW 6 116415463 missense probably damaging 1.00
R2313:Alox5 UTSW 6 116413861 missense probably benign 0.00
R3125:Alox5 UTSW 6 116427137 splice site probably null
R4042:Alox5 UTSW 6 116461018 missense possibly damaging 0.95
R4092:Alox5 UTSW 6 116412674 intron probably benign
R4356:Alox5 UTSW 6 116420258 missense probably benign 0.05
R4367:Alox5 UTSW 6 116460963 missense possibly damaging 0.86
R4690:Alox5 UTSW 6 116423189 missense probably damaging 1.00
R4792:Alox5 UTSW 6 116461003 missense possibly damaging 0.94
R4873:Alox5 UTSW 6 116413850 unclassified probably null
R4875:Alox5 UTSW 6 116413850 unclassified probably null
R5135:Alox5 UTSW 6 116413786 missense probably benign 0.00
R5242:Alox5 UTSW 6 116460966 missense probably damaging 0.97
R5343:Alox5 UTSW 6 116413507 missense possibly damaging 0.95
R5780:Alox5 UTSW 6 116420349 missense probably benign 0.10
R6348:Alox5 UTSW 6 116414595 missense probably damaging 1.00
R6724:Alox5 UTSW 6 116414548 missense probably damaging 1.00
R6769:Alox5 UTSW 6 116415184 intron probably null
R6954:Alox5 UTSW 6 116420280 nonsense probably null
X0028:Alox5 UTSW 6 116424154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCGTACACGTAAACATCCTTCAC -3'
(R):5'- CAGCTTTTGGGGAAAGCAACCAAAC -3'

Sequencing Primer
(F):5'- CTATCAGGAGTGCGTATCCAG -3'
(R):5'- AAACTCAGGCTCTCTGCTC -3'
Posted On2014-04-13