Incidental Mutation 'R1518:Angpt2'
Institutional Source Beutler Lab
Gene Symbol Angpt2
Ensembl Gene ENSMUSG00000031465
Gene Nameangiopoietin 2
SynonymsAng2, Ang-2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.776) question?
Stock #R1518 (G1)
Quality Score225
Status Not validated
Chromosomal Location18690263-18741562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18705839 bp
Amino Acid Change Glutamic Acid to Glycine at position 204 (E204G)
Ref Sequence ENSEMBL: ENSMUSP00000033846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033846] [ENSMUST00000039412] [ENSMUST00000124910]
Predicted Effect probably benign
Transcript: ENSMUST00000033846
AA Change: E204G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033846
Gene: ENSMUSG00000031465
AA Change: E204G

signal peptide 1 18 N/A INTRINSIC
coiled coil region 166 248 N/A INTRINSIC
FBG 279 494 9.43e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

BRCT 13 89 2.64e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an endothelial cell (EC)-derived regulator of angiogenesis and ligand for endothelial-specific receptor tyrosine kinase. The encoded protein acts as an anti-apoptotic factor for stressed ECs and a proapoptotic factor for resting ECs. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene results in impaired angiogenesis, abnormal lymphatic development and function, and ultimately postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,275,369 M493L probably benign Het
Abtb2 G A 2: 103,709,284 V665I probably benign Het
Adamtsl1 C G 4: 86,342,603 S1017W probably damaging Het
Aebp1 A G 11: 5,871,469 T623A possibly damaging Het
Alox5 A G 6: 116,413,780 F470S probably damaging Het
Apip A G 2: 103,089,493 E138G probably damaging Het
Apob C T 12: 7,989,207 T466M probably benign Het
Atp2b3 GACAACA GACA X: 73,545,123 probably benign Het
Atxn7l3 A T 11: 102,294,514 D56E probably benign Het
Cacna1s C T 1: 136,098,551 A1092V probably damaging Het
Calr3 A G 8: 72,427,200 F183L probably damaging Het
Cd300lb T A 11: 114,926,051 D55V probably benign Het
Chid1 A C 7: 141,528,471 V145G probably damaging Het
Chst15 T C 7: 132,270,126 N142S probably damaging Het
Cnot4 C T 6: 35,051,454 R409Q probably damaging Het
Cope T G 8: 70,312,761 I287S possibly damaging Het
Cpd A T 11: 76,840,386 probably null Het
Cux1 G T 5: 136,308,279 T785K probably benign Het
Dthd1 T C 5: 62,822,040 S348P probably damaging Het
Eno3 G T 11: 70,661,077 E64* probably null Het
Entpd1 T A 19: 40,725,063 Y184* probably null Het
Erv3 A T 2: 131,856,163 M92K probably benign Het
Flg2 T A 3: 93,203,138 H824Q unknown Het
Fndc9 G A 11: 46,238,103 G150S probably benign Het
Gdap1 G A 1: 17,146,945 V43I possibly damaging Het
Ifi213 C A 1: 173,589,663 L394F probably damaging Het
Ift88 A G 14: 57,430,628 T29A possibly damaging Het
Kdm4c A T 4: 74,333,826 I437L probably benign Het
Kras T A 6: 145,232,251 E98D probably benign Het
Lcorl C A 5: 45,734,201 R353I possibly damaging Het
Lrrc4c A G 2: 97,630,576 I516V probably benign Het
Lrrc51 T C 7: 101,915,596 D85G probably damaging Het
Lypd6b G A 2: 49,947,492 A159T probably damaging Het
Magel2 G A 7: 62,380,440 V1031I unknown Het
Man1c1 A T 4: 134,580,789 N338K probably benign Het
Mdn1 C A 4: 32,739,977 Q3744K probably damaging Het
Micu3 G T 8: 40,335,852 A135S possibly damaging Het
Muc4 T C 16: 32,750,349 S76P possibly damaging Het
Nin T G 12: 70,014,773 T2106P probably benign Het
Nlrp4e T C 7: 23,321,843 I585T probably benign Het
Npy1r C T 8: 66,704,195 A89V probably benign Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr1220 G A 2: 89,097,600 A109V probably benign Het
Olfr608 T A 7: 103,470,042 M1K probably null Het
Olfr665 T A 7: 104,881,308 Y200* probably null Het
Olfr743 T C 14: 50,534,165 V251A probably damaging Het
Parp14 T G 16: 35,856,638 T987P possibly damaging Het
Pde7b A T 10: 20,548,121 V3E probably damaging Het
Pdlim7 G T 13: 55,508,294 Y104* probably null Het
Pgm2l1 A G 7: 100,261,725 K292R probably benign Het
Plec T C 15: 76,188,201 E728G probably damaging Het
Plppr4 T C 3: 117,335,503 Y105C probably damaging Het
Polr1c A T 17: 46,247,895 N23K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prkca T C 11: 107,978,316 D57G probably damaging Het
Prkcb A G 7: 122,544,631 probably null Het
Prl6a1 C A 13: 27,318,927 Q169K possibly damaging Het
Prl6a1 A T 13: 27,318,928 Q169L probably null Het
Psmd14 G A 2: 61,760,991 R46H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ramp2 A G 11: 101,247,582 T22A probably benign Het
Rbm25 A T 12: 83,668,445 E463D possibly damaging Het
Retnlb A G 16: 48,817,315 I35V probably benign Het
Sestd1 A G 2: 77,241,632 Y49H probably damaging Het
Setd2 T A 9: 110,602,238 I2378N probably damaging Het
Slc26a1 A T 5: 108,671,874 C486* probably null Het
Spef2 T A 15: 9,667,230 I791F probably damaging Het
Sptb T C 12: 76,604,024 T1726A possibly damaging Het
St5 A G 7: 109,557,355 S63P probably damaging Het
Stk38l T A 6: 146,771,631 M296K probably benign Het
Taf5 T C 19: 47,081,846 F624L probably damaging Het
Tmem30c G T 16: 57,266,492 T316K probably damaging Het
Trpm2 A G 10: 77,943,005 S376P possibly damaging Het
Vmn2r82 A T 10: 79,378,868 L228F probably damaging Het
Zfp607b G A 7: 27,698,662 C57Y possibly damaging Het
Zfp983 A G 17: 21,662,353 H399R probably damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Angpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Angpt2 APN 8 18710528 missense probably benign 0.01
IGL01449:Angpt2 APN 8 18710625 missense probably benign 0.01
IGL03088:Angpt2 APN 8 18741023 missense probably benign 0.09
P0037:Angpt2 UTSW 8 18714243 unclassified probably benign
R0308:Angpt2 UTSW 8 18692125 missense possibly damaging 0.93
R1099:Angpt2 UTSW 8 18699133 missense probably damaging 1.00
R1113:Angpt2 UTSW 8 18692118 nonsense probably null
R1264:Angpt2 UTSW 8 18741217 missense probably benign 0.00
R1308:Angpt2 UTSW 8 18692118 nonsense probably null
R1595:Angpt2 UTSW 8 18698113 missense probably damaging 1.00
R2016:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2017:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2050:Angpt2 UTSW 8 18705657 missense probably benign
R2142:Angpt2 UTSW 8 18714140 missense probably benign 0.39
R2184:Angpt2 UTSW 8 18692116 missense probably benign 0.00
R3028:Angpt2 UTSW 8 18703544 missense probably benign 0.01
R4096:Angpt2 UTSW 8 18698095 missense probably damaging 0.97
R4112:Angpt2 UTSW 8 18699123 missense probably damaging 1.00
R4738:Angpt2 UTSW 8 18741059 missense probably benign 0.07
R4790:Angpt2 UTSW 8 18714082 missense probably damaging 1.00
R4935:Angpt2 UTSW 8 18692115 missense probably damaging 1.00
R6056:Angpt2 UTSW 8 18698116 missense probably benign 0.00
R6499:Angpt2 UTSW 8 18694517 missense probably benign
R6938:Angpt2 UTSW 8 18698089 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtgtccagtccctaaatcttc -3'
Posted On2014-04-13