Incidental Mutation 'R1518:Setd2'
ID167201
Institutional Source Beutler Lab
Gene Symbol Setd2
Ensembl Gene ENSMUSG00000044791
Gene NameSET domain containing 2
Synonyms4921524K10Rik, KMT3A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1518 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110532597-110618633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110602238 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2378 (I2378N)
Ref Sequence ENSEMBL: ENSMUSP00000116313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153838] [ENSMUST00000197399]
Predicted Effect probably damaging
Transcript: ENSMUST00000153838
AA Change: I2378N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116313
Gene: ENSMUSG00000044791
AA Change: I2378N

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
low complexity region 156 176 N/A INTRINSIC
low complexity region 185 207 N/A INTRINSIC
low complexity region 297 313 N/A INTRINSIC
low complexity region 392 419 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
low complexity region 1015 1039 N/A INTRINSIC
low complexity region 1066 1077 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
AWS 1468 1523 8.39e-30 SMART
SET 1524 1647 3.07e-41 SMART
PostSET 1648 1664 1.27e-5 SMART
Blast:SET 1689 1714 2e-6 BLAST
low complexity region 1884 1909 N/A INTRINSIC
low complexity region 1956 1967 N/A INTRINSIC
coiled coil region 2090 2113 N/A INTRINSIC
low complexity region 2189 2211 N/A INTRINSIC
low complexity region 2248 2265 N/A INTRINSIC
WW 2363 2395 2.1e-11 SMART
Pfam:SRI 2440 2530 6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196814
Predicted Effect probably damaging
Transcript: ENSMUST00000197399
AA Change: I22N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142572
Gene: ENSMUSG00000044791
AA Change: I22N

DomainStartEndE-ValueType
WW 7 39 2.1e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198697
Predicted Effect unknown
Transcript: ENSMUST00000200460
AA Change: I600N
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein belonging to a class of huntingtin interacting proteins characterized by WW motifs. This protein is a histone methyltransferase that is specific for lysine-36 of histone H3, and methylation of this residue is associated with active chromatin. This protein also contains a novel transcriptional activation domain and has been found associated with hyperphosphorylated RNA polymerase II. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired embryonic vascular remodeling in the embryo proper, yolk sac, and placenta that leads to death around E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,275,369 M493L probably benign Het
Abtb2 G A 2: 103,709,284 V665I probably benign Het
Adamtsl1 C G 4: 86,342,603 S1017W probably damaging Het
Aebp1 A G 11: 5,871,469 T623A possibly damaging Het
Alox5 A G 6: 116,413,780 F470S probably damaging Het
Angpt2 T C 8: 18,705,839 E204G probably benign Het
Apip A G 2: 103,089,493 E138G probably damaging Het
Apob C T 12: 7,989,207 T466M probably benign Het
Atp2b3 GACAACA GACA X: 73,545,123 probably benign Het
Atxn7l3 A T 11: 102,294,514 D56E probably benign Het
Cacna1s C T 1: 136,098,551 A1092V probably damaging Het
Calr3 A G 8: 72,427,200 F183L probably damaging Het
Cd300lb T A 11: 114,926,051 D55V probably benign Het
Chid1 A C 7: 141,528,471 V145G probably damaging Het
Chst15 T C 7: 132,270,126 N142S probably damaging Het
Cnot4 C T 6: 35,051,454 R409Q probably damaging Het
Cope T G 8: 70,312,761 I287S possibly damaging Het
Cpd A T 11: 76,840,386 probably null Het
Cux1 G T 5: 136,308,279 T785K probably benign Het
Dthd1 T C 5: 62,822,040 S348P probably damaging Het
Eno3 G T 11: 70,661,077 E64* probably null Het
Entpd1 T A 19: 40,725,063 Y184* probably null Het
Erv3 A T 2: 131,856,163 M92K probably benign Het
Flg2 T A 3: 93,203,138 H824Q unknown Het
Fndc9 G A 11: 46,238,103 G150S probably benign Het
Gdap1 G A 1: 17,146,945 V43I possibly damaging Het
Ifi213 C A 1: 173,589,663 L394F probably damaging Het
Ift88 A G 14: 57,430,628 T29A possibly damaging Het
Kdm4c A T 4: 74,333,826 I437L probably benign Het
Kras T A 6: 145,232,251 E98D probably benign Het
Lcorl C A 5: 45,734,201 R353I possibly damaging Het
Lrrc4c A G 2: 97,630,576 I516V probably benign Het
Lrrc51 T C 7: 101,915,596 D85G probably damaging Het
Lypd6b G A 2: 49,947,492 A159T probably damaging Het
Magel2 G A 7: 62,380,440 V1031I unknown Het
Man1c1 A T 4: 134,580,789 N338K probably benign Het
Mdn1 C A 4: 32,739,977 Q3744K probably damaging Het
Micu3 G T 8: 40,335,852 A135S possibly damaging Het
Muc4 T C 16: 32,750,349 S76P possibly damaging Het
Nin T G 12: 70,014,773 T2106P probably benign Het
Nlrp4e T C 7: 23,321,843 I585T probably benign Het
Npy1r C T 8: 66,704,195 A89V probably benign Het
Olfr1136 A T 2: 87,693,528 M118K probably damaging Het
Olfr1220 G A 2: 89,097,600 A109V probably benign Het
Olfr608 T A 7: 103,470,042 M1K probably null Het
Olfr665 T A 7: 104,881,308 Y200* probably null Het
Olfr743 T C 14: 50,534,165 V251A probably damaging Het
Parp14 T G 16: 35,856,638 T987P possibly damaging Het
Pde7b A T 10: 20,548,121 V3E probably damaging Het
Pdlim7 G T 13: 55,508,294 Y104* probably null Het
Pgm2l1 A G 7: 100,261,725 K292R probably benign Het
Plec T C 15: 76,188,201 E728G probably damaging Het
Plppr4 T C 3: 117,335,503 Y105C probably damaging Het
Polr1c A T 17: 46,247,895 N23K possibly damaging Het
Ppp5c A T 7: 17,009,936 M191K probably damaging Het
Prkca T C 11: 107,978,316 D57G probably damaging Het
Prkcb A G 7: 122,544,631 probably null Het
Prl6a1 C A 13: 27,318,927 Q169K possibly damaging Het
Prl6a1 A T 13: 27,318,928 Q169L probably null Het
Psmd14 G A 2: 61,760,991 R46H probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ramp2 A G 11: 101,247,582 T22A probably benign Het
Rbm19 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 5: 120,140,280 probably benign Het
Rbm25 A T 12: 83,668,445 E463D possibly damaging Het
Retnlb A G 16: 48,817,315 I35V probably benign Het
Sestd1 A G 2: 77,241,632 Y49H probably damaging Het
Slc26a1 A T 5: 108,671,874 C486* probably null Het
Spef2 T A 15: 9,667,230 I791F probably damaging Het
Sptb T C 12: 76,604,024 T1726A possibly damaging Het
St5 A G 7: 109,557,355 S63P probably damaging Het
Stk38l T A 6: 146,771,631 M296K probably benign Het
Taf5 T C 19: 47,081,846 F624L probably damaging Het
Tmem30c G T 16: 57,266,492 T316K probably damaging Het
Trpm2 A G 10: 77,943,005 S376P possibly damaging Het
Vmn2r82 A T 10: 79,378,868 L228F probably damaging Het
Zfp607b G A 7: 27,698,662 C57Y possibly damaging Het
Zfp983 A G 17: 21,662,353 H399R probably damaging Het
Zfp984 A T 4: 147,755,545 M283K probably benign Het
Other mutations in Setd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Setd2 APN 9 110551136 missense possibly damaging 0.94
IGL01023:Setd2 APN 9 110547513 nonsense probably null
IGL01063:Setd2 APN 9 110573673 missense probably damaging 1.00
IGL01745:Setd2 APN 9 110594711 missense probably damaging 0.99
IGL01911:Setd2 APN 9 110617431 splice site probably null
IGL01955:Setd2 APN 9 110549318 missense probably benign 0.38
IGL02023:Setd2 APN 9 110594636 missense probably benign 0.06
IGL02080:Setd2 APN 9 110547450 unclassified probably null
IGL02412:Setd2 APN 9 110550774 missense probably benign 0.00
IGL02519:Setd2 APN 9 110553116 missense probably damaging 0.97
IGL02631:Setd2 APN 9 110550576 missense possibly damaging 0.80
IGL02754:Setd2 APN 9 110550056 missense possibly damaging 0.77
IGL02828:Setd2 APN 9 110561214 missense probably benign 0.31
IGL03033:Setd2 APN 9 110551275 missense possibly damaging 0.96
IGL03140:Setd2 APN 9 110614952 critical splice donor site probably null
IGL03378:Setd2 APN 9 110553152 missense unknown
American_samoa UTSW 9 110567758 nonsense probably null
slingshot UTSW 9 110549507 missense probably benign 0.00
P0028:Setd2 UTSW 9 110573954 missense probably benign 0.00
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0058:Setd2 UTSW 9 110594426 missense probably damaging 0.98
R0167:Setd2 UTSW 9 110573782 missense probably damaging 1.00
R0408:Setd2 UTSW 9 110594242 missense probably damaging 1.00
R0452:Setd2 UTSW 9 110553100 splice site probably null
R0541:Setd2 UTSW 9 110573673 missense probably damaging 1.00
R0947:Setd2 UTSW 9 110548511 missense possibly damaging 0.87
R1249:Setd2 UTSW 9 110573880 missense probably damaging 0.99
R1294:Setd2 UTSW 9 110549507 missense probably benign 0.00
R1585:Setd2 UTSW 9 110551396 missense unknown
R1647:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1649:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1651:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1652:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1673:Setd2 UTSW 9 110604180 missense probably damaging 0.97
R1703:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1706:Setd2 UTSW 9 110549864 missense probably benign 0.12
R1709:Setd2 UTSW 9 110549857 missense probably benign 0.00
R1752:Setd2 UTSW 9 110594605 missense probably damaging 1.00
R1796:Setd2 UTSW 9 110550345 missense probably benign 0.01
R1796:Setd2 UTSW 9 110617816 critical splice acceptor site probably null
R1812:Setd2 UTSW 9 110550102 missense probably damaging 0.99
R1884:Setd2 UTSW 9 110556418 critical splice donor site probably null
R2024:Setd2 UTSW 9 110549133 missense possibly damaging 0.65
R2051:Setd2 UTSW 9 110550890 missense probably benign
R2117:Setd2 UTSW 9 110604144 frame shift probably null
R2120:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2124:Setd2 UTSW 9 110549864 missense probably benign 0.12
R2172:Setd2 UTSW 9 110549844 missense probably benign 0.10
R2179:Setd2 UTSW 9 110594688 nonsense probably null
R2262:Setd2 UTSW 9 110561243 intron probably benign
R2411:Setd2 UTSW 9 110550429 missense possibly damaging 0.46
R2413:Setd2 UTSW 9 110547504 missense probably damaging 1.00
R2419:Setd2 UTSW 9 110548997 missense possibly damaging 0.48
R2424:Setd2 UTSW 9 110617522 missense probably benign 0.37
R3757:Setd2 UTSW 9 110573685 missense probably damaging 0.99
R3765:Setd2 UTSW 9 110594246 missense probably damaging 1.00
R3796:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3797:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3799:Setd2 UTSW 9 110549571 missense probably benign 0.00
R3899:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3900:Setd2 UTSW 9 110592518 missense probably damaging 1.00
R3913:Setd2 UTSW 9 110551046 missense probably damaging 0.99
R4010:Setd2 UTSW 9 110599195 missense probably null 1.00
R4580:Setd2 UTSW 9 110574243 missense probably benign 0.06
R4614:Setd2 UTSW 9 110569813 critical splice donor site probably null
R4651:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4652:Setd2 UTSW 9 110594132 missense possibly damaging 0.53
R4855:Setd2 UTSW 9 110571954 missense probably benign 0.02
R4970:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5112:Setd2 UTSW 9 110548158 missense probably benign 0.28
R5123:Setd2 UTSW 9 110617527 missense possibly damaging 0.76
R5140:Setd2 UTSW 9 110551129 missense probably benign 0.00
R5202:Setd2 UTSW 9 110551230 missense probably damaging 1.00
R5290:Setd2 UTSW 9 110617831 missense probably damaging 1.00
R5560:Setd2 UTSW 9 110549839 nonsense probably null
R5604:Setd2 UTSW 9 110604216 missense probably damaging 0.99
R5678:Setd2 UTSW 9 110602186 missense probably damaging 0.99
R5708:Setd2 UTSW 9 110548823 missense possibly damaging 0.59
R5763:Setd2 UTSW 9 110556275 splice site probably null
R5814:Setd2 UTSW 9 110567758 nonsense probably null
R5924:Setd2 UTSW 9 110574044 missense probably benign 0.23
R6244:Setd2 UTSW 9 110548665 missense probably damaging 1.00
R6313:Setd2 UTSW 9 110556366 missense unknown
R6431:Setd2 UTSW 9 110550385 missense possibly damaging 0.65
R6526:Setd2 UTSW 9 110532717 missense probably benign 0.33
R6579:Setd2 UTSW 9 110549778 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACAGAGATTACAAGGCGGCATCAG -3'
(R):5'- ACCCACATGGGATTTTAGAAATTCAGCA -3'

Sequencing Primer
(F):5'- agccatctcaccagccc -3'
(R):5'- CAGCAGTCCAACTTTAGATCAGTG -3'
Posted On2014-04-13