Incidental Mutation 'R1520:Sv2b'
ID167374
Institutional Source Beutler Lab
Gene Symbol Sv2b
Ensembl Gene ENSMUSG00000053025
Gene Namesynaptic vesicle glycoprotein 2 b
SynonymsA830038F04Rik
MMRRC Submission 039564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1520 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location75114894-75309262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75157329 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 191 (L191P)
Ref Sequence ENSEMBL: ENSMUSP00000146049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]
Predicted Effect probably damaging
Transcript: ENSMUST00000085164
AA Change: L191P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025
AA Change: L191P

DomainStartEndE-ValueType
Pfam:Sugar_tr 93 415 3.8e-29 PFAM
Pfam:MFS_1 111 429 9.3e-25 PFAM
Pfam:MFS_1 517 681 8.2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165175
AA Change: L191P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025
AA Change: L191P

DomainStartEndE-ValueType
Pfam:Sugar_tr 89 412 1.5e-29 PFAM
Pfam:MFS_1 111 429 9.5e-25 PFAM
Pfam:Pentapeptide_4 453 528 7.9e-11 PFAM
Pfam:MFS_1 516 681 5.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206344
AA Change: L191P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206845
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,297 Y410* probably null Het
1810011H11Rik A T 14: 32,805,126 probably benign Het
Abca7 A G 10: 80,008,830 N1491S possibly damaging Het
Abcb1b G A 5: 8,814,768 A249T probably damaging Het
Acacb A G 5: 114,201,940 D804G possibly damaging Het
Agpat3 A T 10: 78,288,023 M1K probably null Het
Akr1c12 A C 13: 4,276,299 I61R probably damaging Het
Antxr2 G A 5: 97,960,692 A320V probably benign Het
Arhgef1 A G 7: 24,919,704 R454G probably damaging Het
C1ql4 T C 15: 99,087,667 H21R probably benign Het
Celsr3 T C 9: 108,848,658 S3029P probably damaging Het
Chaf1a T C 17: 56,047,302 C191R unknown Het
Corin A C 5: 72,330,895 C627G probably damaging Het
Cyp3a11 T C 5: 145,862,453 Y308C probably damaging Het
Cyp4a32 A G 4: 115,614,652 N420S probably damaging Het
Eftud2 A G 11: 102,839,440 S889P probably damaging Het
Eng A G 2: 32,672,941 H267R probably benign Het
Ep400 A G 5: 110,691,778 probably benign Het
Fmo9 G T 1: 166,667,455 H292Q probably benign Het
Frmpd4 T C X: 167,492,953 S373G probably damaging Het
Fsip2 T A 2: 82,980,714 I2459K possibly damaging Het
Gbp5 A T 3: 142,508,014 H523L probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gpr65 T C 12: 98,275,175 V29A probably benign Het
Igkv7-33 T A 6: 70,059,148 probably benign Het
Iqcc G A 4: 129,616,969 T251I possibly damaging Het
Jund A G 8: 70,699,274 T73A probably benign Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Mcm8 T C 2: 132,839,455 V617A probably benign Het
Mdga1 A G 17: 29,846,519 F646L probably benign Het
Morc3 A G 16: 93,844,241 K54E probably damaging Het
Mutyh T C 4: 116,817,552 L357P probably damaging Het
Mylk4 T C 13: 32,712,838 probably null Het
Olfr1287 G A 2: 111,449,274 V45I probably benign Het
Osbpl3 T A 6: 50,346,431 D224V possibly damaging Het
Parp4 T C 14: 56,598,406 I469T probably damaging Het
Pkd1l2 A G 8: 117,046,159 V1043A probably benign Het
Plod3 A G 5: 136,991,311 N460S probably damaging Het
Preb A G 5: 30,958,524 F192L probably benign Het
Prkra T C 2: 76,639,278 T146A possibly damaging Het
Rag2 T C 2: 101,630,131 I262T probably damaging Het
Rgr A G 14: 37,044,715 W125R probably damaging Het
Rit1 T A 3: 88,729,313 F211I probably benign Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Serinc2 C T 4: 130,260,750 V234I probably benign Het
Srp54b T C 12: 55,257,569 M434T possibly damaging Het
Srrt C A 5: 137,298,766 R69L probably damaging Het
Tcf12 C A 9: 71,883,106 probably null Het
Tmem87b T C 2: 128,839,256 probably null Het
Ttn T C 2: 76,817,048 E11031G possibly damaging Het
Uaca A T 9: 60,871,381 T1017S probably benign Het
Urb1 C A 16: 90,774,745 V1059L probably benign Het
V1rd19 G A 7: 24,003,198 A30T probably damaging Het
Vldlr C T 19: 27,240,543 L91F probably damaging Het
Vldlr G T 19: 27,247,066 A770S possibly damaging Het
Vmn2r80 A G 10: 79,194,760 T807A probably damaging Het
Wwox C T 8: 114,712,133 P313L probably benign Het
Zap70 T C 1: 36,770,955 S49P probably damaging Het
Zfp317 A G 9: 19,647,848 I453V possibly damaging Het
Other mutations in Sv2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01463:Sv2b APN 7 75136455 missense probably damaging 1.00
IGL02302:Sv2b APN 7 75124199 missense probably damaging 0.98
IGL02352:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02359:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02698:Sv2b APN 7 75140978 critical splice donor site probably null
IGL02713:Sv2b APN 7 75124163 missense possibly damaging 0.66
IGL03075:Sv2b APN 7 75136320 missense probably benign
IGL03392:Sv2b APN 7 75156760 critical splice acceptor site probably null
R0015:Sv2b UTSW 7 75125641 missense probably damaging 1.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0219:Sv2b UTSW 7 75157267 critical splice donor site probably null
R0277:Sv2b UTSW 7 75206439 missense possibly damaging 0.62
R0469:Sv2b UTSW 7 75136392 missense probably benign
R0510:Sv2b UTSW 7 75136392 missense probably benign
R1219:Sv2b UTSW 7 75136412 missense probably benign 0.01
R1307:Sv2b UTSW 7 75206434 missense probably damaging 1.00
R1476:Sv2b UTSW 7 75120043 missense possibly damaging 0.72
R1575:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1585:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1666:Sv2b UTSW 7 75206341 missense probably benign 0.01
R1712:Sv2b UTSW 7 75149059 missense possibly damaging 0.78
R1864:Sv2b UTSW 7 75124080 missense probably benign 0.17
R1993:Sv2b UTSW 7 75206341 missense probably benign 0.01
R2191:Sv2b UTSW 7 75124088 missense probably damaging 1.00
R3836:Sv2b UTSW 7 75157428 missense probably damaging 1.00
R4744:Sv2b UTSW 7 75206518 missense probably benign 0.01
R4757:Sv2b UTSW 7 75124170 missense probably benign 0.31
R4924:Sv2b UTSW 7 75136421 missense probably benign 0.20
R4990:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R4991:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R5038:Sv2b UTSW 7 75157425 missense probably damaging 1.00
R5726:Sv2b UTSW 7 75124214 missense possibly damaging 0.67
R5885:Sv2b UTSW 7 75156753 missense probably damaging 1.00
R6379:Sv2b UTSW 7 75136300 missense possibly damaging 0.73
R6410:Sv2b UTSW 7 75140109 missense probably benign 0.40
R6623:Sv2b UTSW 7 75206384 missense probably damaging 1.00
R6709:Sv2b UTSW 7 75124139 missense probably benign 0.40
R6873:Sv2b UTSW 7 75206206 missense probably damaging 1.00
R6889:Sv2b UTSW 7 75125767 intron probably null
Predicted Primers PCR Primer
(F):5'- ACCAGCAATGAGGCTTTCCCTACA -3'
(R):5'- CCAATGCTCCTGGTCTTGGGTTAGT -3'

Sequencing Primer
(F):5'- cacttctacccaccaagcc -3'
(R):5'- GGTTAGTTCACTACAAAGCCCAAG -3'
Posted On2014-04-13