Incidental Mutation 'R1520:Agpat3'
List |< first << previous [record 63 of 1308] next >> last >|
ID167385
Institutional Source Beutler Lab
Gene Symbol Agpat3
Ensembl Gene ENSMUSG00000001211
Gene Name1-acylglycerol-3-phosphate O-acyltransferase 3
SynonymsD10Jhu12e, LPAAT3
MMRRC Submission 039564-MU
Accession Numbers

NCBI RefSeq: NM_053014.3; MGI: 1336186

Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1520 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78269178-78352489 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 78288023 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000132954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001240] [ENSMUST00000105387] [ENSMUST00000105388] [ENSMUST00000105389] [ENSMUST00000105390] [ENSMUST00000138035] [ENSMUST00000139282] [ENSMUST00000146899] [ENSMUST00000150828] [ENSMUST00000166360] [ENSMUST00000219932]
Predicted Effect probably null
Transcript: ENSMUST00000001240
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001240
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105387
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101026
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105388
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101027
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105389
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101028
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105390
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101029
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000138035
AA Change: M1K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121052
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139282
AA Change: M1K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119713
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Acyltransferase 72 144 3.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146899
AA Change: M1K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114657
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150828
AA Change: M1K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114885
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Blast:PlsC 90 129 5e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000166360
AA Change: M1K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132954
Gene: ENSMUSG00000001211
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
Pfam:Acyltransf_C 241 314 2.1e-29 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219907
Predicted Effect unknown
Transcript: ENSMUST00000219932
AA Change: H1Q
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an acyltransferase that converts lysophosphatidic acid into phosphatidic acid, which is the second step in the de novo phospholipid biosynthetic pathway. The encoded protein may be an integral membrane protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, teratozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(2) Gene trapped(12)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,297 Y410* probably null Het
1810011H11Rik A T 14: 32,805,126 probably benign Het
Abca7 A G 10: 80,008,830 N1491S possibly damaging Het
Abcb1b G A 5: 8,814,768 A249T probably damaging Het
Acacb A G 5: 114,201,940 D804G possibly damaging Het
Akr1c12 A C 13: 4,276,299 I61R probably damaging Het
Antxr2 G A 5: 97,960,692 A320V probably benign Het
Arhgef1 A G 7: 24,919,704 R454G probably damaging Het
C1ql4 T C 15: 99,087,667 H21R probably benign Het
Celsr3 T C 9: 108,848,658 S3029P probably damaging Het
Chaf1a T C 17: 56,047,302 C191R unknown Het
Corin A C 5: 72,330,895 C627G probably damaging Het
Cyp3a11 T C 5: 145,862,453 Y308C probably damaging Het
Cyp4a32 A G 4: 115,614,652 N420S probably damaging Het
Eftud2 A G 11: 102,839,440 S889P probably damaging Het
Eng A G 2: 32,672,941 H267R probably benign Het
Ep400 A G 5: 110,691,778 probably benign Het
Fmo9 G T 1: 166,667,455 H292Q probably benign Het
Frmpd4 T C X: 167,492,953 S373G probably damaging Het
Fsip2 T A 2: 82,980,714 I2459K possibly damaging Het
Gbp5 A T 3: 142,508,014 H523L probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gpr65 T C 12: 98,275,175 V29A probably benign Het
Igkv7-33 T A 6: 70,059,148 probably benign Het
Iqcc G A 4: 129,616,969 T251I possibly damaging Het
Jund A G 8: 70,699,274 T73A probably benign Het
Kif14 A G 1: 136,503,324 D1153G probably benign Het
Mcm8 T C 2: 132,839,455 V617A probably benign Het
Mdga1 A G 17: 29,846,519 F646L probably benign Het
Morc3 A G 16: 93,844,241 K54E probably damaging Het
Mutyh T C 4: 116,817,552 L357P probably damaging Het
Mylk4 T C 13: 32,712,838 probably null Het
Olfr1287 G A 2: 111,449,274 V45I probably benign Het
Osbpl3 T A 6: 50,346,431 D224V possibly damaging Het
Parp4 T C 14: 56,598,406 I469T probably damaging Het
Pkd1l2 A G 8: 117,046,159 V1043A probably benign Het
Plod3 A G 5: 136,991,311 N460S probably damaging Het
Preb A G 5: 30,958,524 F192L probably benign Het
Prkra T C 2: 76,639,278 T146A possibly damaging Het
Rag2 T C 2: 101,630,131 I262T probably damaging Het
Rgr A G 14: 37,044,715 W125R probably damaging Het
Rit1 T A 3: 88,729,313 F211I probably benign Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Serinc2 C T 4: 130,260,750 V234I probably benign Het
Srp54b T C 12: 55,257,569 M434T possibly damaging Het
Srrt C A 5: 137,298,766 R69L probably damaging Het
Sv2b A G 7: 75,157,329 L191P probably damaging Het
Tcf12 C A 9: 71,883,106 probably null Het
Tmem87b T C 2: 128,839,256 probably null Het
Ttn T C 2: 76,817,048 E11031G possibly damaging Het
Uaca A T 9: 60,871,381 T1017S probably benign Het
Urb1 C A 16: 90,774,745 V1059L probably benign Het
V1rd19 G A 7: 24,003,198 A30T probably damaging Het
Vldlr C T 19: 27,240,543 L91F probably damaging Het
Vldlr G T 19: 27,247,066 A770S possibly damaging Het
Vmn2r80 A G 10: 79,194,760 T807A probably damaging Het
Wwox C T 8: 114,712,133 P313L probably benign Het
Zap70 T C 1: 36,770,955 S49P probably damaging Het
Zfp317 A G 9: 19,647,848 I453V possibly damaging Het
Other mutations in Agpat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Agpat3 APN 10 78273682 utr 3 prime probably benign
IGL02621:Agpat3 APN 10 78285066 missense probably damaging 1.00
IGL02725:Agpat3 APN 10 78278055 missense probably benign 0.02
P0008:Agpat3 UTSW 10 78287876 missense probably damaging 1.00
R0041:Agpat3 UTSW 10 78288047 unclassified probably benign
R0126:Agpat3 UTSW 10 78278056 missense probably null 0.59
R0226:Agpat3 UTSW 10 78278029 missense possibly damaging 0.89
R2118:Agpat3 UTSW 10 78278084 missense probably damaging 1.00
R5493:Agpat3 UTSW 10 78284235 missense possibly damaging 0.89
R5599:Agpat3 UTSW 10 78274269 missense probably benign 0.39
R6280:Agpat3 UTSW 10 78285038 missense probably damaging 1.00
X0003:Agpat3 UTSW 10 78274173 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGACCTCAGGGAACCAGAGATGC -3'
(R):5'- TGTTTGTCCATCAGCTTTCCAGGG -3'

Sequencing Primer
(F):5'- CTTATGGGCGAGGACACTTAC -3'
(R):5'- GGGCAGCCTCTCTCTAAAC -3'
Posted On2014-04-13