Incidental Mutation 'R1526:Olfr1179'
ID167416
Institutional Source Beutler Lab
Gene Symbol Olfr1179
Ensembl Gene ENSMUSG00000075127
Gene Nameolfactory receptor 1179
SynonymsMOR225-2, GA_x6K02T2Q125-49890854-49889931
MMRRC Submission 039566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R1526 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88401859-88406453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88402433 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 167 (C167Y)
Ref Sequence ENSEMBL: ENSMUSP00000151174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099825] [ENSMUST00000213157] [ENSMUST00000214040]
Predicted Effect probably damaging
Transcript: ENSMUST00000099825
AA Change: C167Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097413
Gene: ENSMUSG00000075127
AA Change: C167Y

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-47 PFAM
Pfam:7tm_1 39 285 3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213157
AA Change: C167Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219086
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Olfr1179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr1179 APN 2 88402077 missense possibly damaging 0.95
IGL02445:Olfr1179 APN 2 88402112 missense possibly damaging 0.60
R0127:Olfr1179 UTSW 2 88402355 missense probably benign 0.05
R0604:Olfr1179 UTSW 2 88402383 missense probably benign 0.03
R1816:Olfr1179 UTSW 2 88402599 missense possibly damaging 0.65
R2041:Olfr1179 UTSW 2 88402224 missense probably damaging 1.00
R3694:Olfr1179 UTSW 2 88402196 missense possibly damaging 0.80
R4229:Olfr1179 UTSW 2 88402883 missense possibly damaging 0.67
R4735:Olfr1179 UTSW 2 88402923 missense probably benign 0.02
R4974:Olfr1179 UTSW 2 88402412 missense probably damaging 1.00
R5173:Olfr1179 UTSW 2 88402922 missense probably benign 0.00
R5909:Olfr1179 UTSW 2 88402191 missense probably damaging 0.98
R6931:Olfr1179 UTSW 2 88402064 missense probably benign 0.01
R6990:Olfr1179 UTSW 2 88402295 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTGGCACCAAACTTTTCTCAAGGC -3'
(R):5'- GTGACACCCAAGTTTCTCACTGACC -3'

Sequencing Primer
(F):5'- TGCAGGATAAGCCCTGATG -3'
(R):5'- GAGGGATTGAGATCCTCATACTCAC -3'
Posted On2014-04-13