Incidental Mutation 'R1526:Il5ra'
ID167426
Institutional Source Beutler Lab
Gene Symbol Il5ra
Ensembl Gene ENSMUSG00000005364
Gene Nameinterleukin 5 receptor, alpha
SynonymsCDw125, IL-5 receptor alpha chain, CD125, Il5r
MMRRC Submission 039566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1526 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location106710357-106749037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106735820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 244 (V244E)
Ref Sequence ENSEMBL: ENSMUSP00000144718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167925] [ENSMUST00000204659] [ENSMUST00000205004]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167925
AA Change: V244E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129781
Gene: ENSMUSG00000005364
AA Change: V244E

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204659
AA Change: V244E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144718
Gene: ENSMUSG00000005364
AA Change: V244E

DomainStartEndE-ValueType
FN3 27 159 6.27e0 SMART
FN3 236 312 1.28e1 SMART
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205004
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a generally normal phenotype but with some immune system deficiencies. Mice homozygous for one knock-out allele exhibit increased metastasis of injected B16F10 melanoma cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Il5ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Il5ra APN 6 106712474 splice site probably benign
IGL00726:Il5ra APN 6 106738489 missense probably damaging 1.00
IGL01095:Il5ra APN 6 106742644 intron probably benign
IGL01562:Il5ra APN 6 106731904 missense probably benign 0.00
IGL01569:Il5ra APN 6 106731833 start codon destroyed probably null
IGL02346:Il5ra APN 6 106742658 missense probably benign 0.02
IGL02573:Il5ra APN 6 106716751 missense possibly damaging 0.93
IGL02659:Il5ra APN 6 106742683 missense possibly damaging 0.49
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0037:Il5ra UTSW 6 106742686 missense probably damaging 1.00
R0294:Il5ra UTSW 6 106712401 missense probably benign 0.41
R0463:Il5ra UTSW 6 106731890 missense probably damaging 0.99
R0478:Il5ra UTSW 6 106738462 missense probably benign
R0597:Il5ra UTSW 6 106744335 start codon destroyed probably null 0.99
R1695:Il5ra UTSW 6 106738374 nonsense probably null
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R1888:Il5ra UTSW 6 106731913 missense probably damaging 1.00
R2176:Il5ra UTSW 6 106738272 missense probably benign
R2207:Il5ra UTSW 6 106712441 nonsense probably null
R2973:Il5ra UTSW 6 106741235 missense probably benign 0.08
R4546:Il5ra UTSW 6 106738498 nonsense probably null
R4842:Il5ra UTSW 6 106738375 missense probably damaging 1.00
R4851:Il5ra UTSW 6 106738471 missense probably benign 0.06
R4911:Il5ra UTSW 6 106715668 missense probably damaging 1.00
R4936:Il5ra UTSW 6 106738162 missense possibly damaging 0.90
R5297:Il5ra UTSW 6 106738134 missense probably benign 0.09
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
R6035:Il5ra UTSW 6 106741265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGGGCAGTCAATACTGAAACT -3'
(R):5'- TGCACAATACAGTGAGTGAGCTGAG -3'

Sequencing Primer
(F):5'- gaagataccacaacacgaagaac -3'
(R):5'- GTCTATTTGGTACAGCCAAACC -3'
Posted On2014-04-13