Incidental Mutation 'R1526:Cemip'
ID167432
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission 039566-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.435) question?
Stock #R1526 (G1)
Quality Score220
Status Not validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83951440 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 991 (D991G)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably damaging
Transcript: ENSMUST00000064174
AA Change: D991G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: D991G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150495
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6505:Cemip UTSW 7 83951597 nonsense probably null
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTGCATCATTCTTGGCCCAAC -3'
(R):5'- AAACTTTGCCCTGGCCTGATGACG -3'

Sequencing Primer
(F):5'- TTGGCCCAACATAGAACTAACTGG -3'
(R):5'- GGGCTCTGTTCAGATTACTTCCAG -3'
Posted On2014-04-13