Incidental Mutation 'R1526:Nek1'
ID167438
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 039566-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1526 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61049941 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 449 (P449L)
Ref Sequence ENSEMBL: ENSMUSP00000147258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably benign
Transcript: ENSMUST00000034065
AA Change: P474L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: P474L

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120689
AA Change: P474L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: P474L

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142601
SMART Domains Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
coiled coil region 162 198 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect probably benign
Transcript: ENSMUST00000211256
AA Change: P449L

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211661
Predicted Effect probably benign
Transcript: ENSMUST00000211672
AA Change: P474L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1808:Nek1 UTSW 8 61016230 missense probably damaging 1.00
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
R7356:Nek1 UTSW 8 61120960 missense probably benign 0.02
R7368:Nek1 UTSW 8 61089707 missense probably benign 0.24
R7478:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7479:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7512:Nek1 UTSW 8 61130145 missense probably benign 0.03
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAACCTTTTACTTTCGGCCATGCG -3'
(R):5'- AGACACGGCCTTCAGTCTTTTCAG -3'

Sequencing Primer
(F):5'- GGCCATGCGTTTACCAATATG -3'
(R):5'- GAGTTTTCCTAATAGCACCAGC -3'
Posted On2014-04-13