Incidental Mutation 'R1526:Cideb'
ID167463
Institutional Source Beutler Lab
Gene Symbol Cideb
Ensembl Gene ENSMUSG00000022219
Gene Namecell death-inducing DNA fragmentation factor, alpha subunit-like effector B
Synonyms1110030C18Rik, CIDE-B, DFFA-like B
MMRRC Submission 039566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1526 (G1)
Quality Score172
Status Not validated
Chromosome14
Chromosomal Location55754050-55758458 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 55755162 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 99 (L99*)
Ref Sequence ENSEMBL: ENSMUSP00000001497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001497] [ENSMUST00000019441]
Predicted Effect probably null
Transcript: ENSMUST00000001497
AA Change: L99*
SMART Domains Protein: ENSMUSP00000001497
Gene: ENSMUSG00000022219
AA Change: L99*

DomainStartEndE-ValueType
CAD 36 108 2.16e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000019441
SMART Domains Protein: ENSMUSP00000019441
Gene: ENSMUSG00000019297

DomainStartEndE-ValueType
low complexity region 11 55 N/A INTRINSIC
Blast:Pumilio 92 127 3e-15 BLAST
Pumilio 189 220 2.74e2 SMART
Blast:Pumilio 263 298 3e-14 BLAST
Pumilio 314 349 4.38e1 SMART
Pumilio 351 387 1.03e1 SMART
Pumilio 509 546 1.72e1 SMART
Pumilio 547 582 9.17e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227300
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a lean phenotype, increased energy expenditure and improved insulin sensitivity and are resistant to high-fat diet-induced obesity, hyperlipidemia, or liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Cideb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Cideb APN 14 55754560 missense possibly damaging 0.78
Oxymoron UTSW 14 55757952 missense probably benign 0.43
R1920:Cideb UTSW 14 55755243 missense probably benign
R2073:Cideb UTSW 14 55755160 missense possibly damaging 0.88
R4584:Cideb UTSW 14 55758270 missense probably benign
R4650:Cideb UTSW 14 55755231 missense possibly damaging 0.92
R5106:Cideb UTSW 14 55754525 missense probably benign
R5415:Cideb UTSW 14 55757855 missense probably damaging 1.00
R5420:Cideb UTSW 14 55758291 start codon destroyed probably null 1.00
R6471:Cideb UTSW 14 55757952 missense probably benign 0.43
X0064:Cideb UTSW 14 55757976 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATCATTGAAGTGGACCTGCCCTC -3'
(R):5'- AGCTGATATGCCAACCAGCGTGAG -3'

Sequencing Primer
(F):5'- ACTAATCCTGTCAGTGCCG -3'
(R):5'- AACCAGCGTGAGGCTGAC -3'
Posted On2014-04-13