Incidental Mutation 'R1526:Drosha'
ID167465
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
MMRRC Submission 039566-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1526 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12913984 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1115 (V1115E)
Ref Sequence ENSEMBL: ENSMUSP00000129279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect probably damaging
Transcript: ENSMUST00000090292
AA Change: V1115E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: V1115E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121499
Gene: ENSMUSG00000022191
AA Change: V757E

DomainStartEndE-ValueType
low complexity region 115 142 N/A INTRINSIC
SCOP:d1jfza_ 521 545 6e-4 SMART
RIBOc 585 719 1.73e-45 SMART
Blast:RIBOc 729 755 1e-6 BLAST
RIBOc 764 896 1.6e-49 SMART
DSRM 903 975 5.75e-20 SMART
coiled coil region 988 1012 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169061
AA Change: V1115E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: V1115E

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R6920:Drosha UTSW 15 12834310 missense unknown
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense not run
R7559:Drosha UTSW 15 12842422 missense not run
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- ACAGCCGTTCCCATTTCCTAGAAAC -3'
(R):5'- GCAGTGTGTCTGCCCTCTAAGTTC -3'

Sequencing Primer
(F):5'- acacacacacacacacacac -3'
(R):5'- CTCTAAGTTCCTCTGAAGGGCAG -3'
Posted On2014-04-13