Incidental Mutation 'R1526:Dzip3'
ID167472
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 039566-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1526 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 48937006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 888 (L888R)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably damaging
Transcript: ENSMUST00000114516
AA Change: L682R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061
AA Change: L682R

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121869
AA Change: L888R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: L888R

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147358
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Emx2 C A 19: 59,464,010 A242E probably benign Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense not run
Predicted Primers PCR Primer
(F):5'- GGGGAGGAAGTTGCCACTGTATTC -3'
(R):5'- GAGGTCCATTTGGACTATGCCCTG -3'

Sequencing Primer
(F):5'- GTGCTTGTCAATAATTCAGCAGATG -3'
(R):5'- ccaggggaccaaggcac -3'
Posted On2014-04-13