Incidental Mutation 'R1526:Emx2'
ID167481
Institutional Source Beutler Lab
Gene Symbol Emx2
Ensembl Gene ENSMUSG00000043969
Gene Nameempty spiracles homeobox 2
SynonymsPdo
MMRRC Submission 039566-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1526 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location59458372-59465357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59464010 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 242 (A242E)
Ref Sequence ENSEMBL: ENSMUSP00000053361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062216] [ENSMUST00000174353]
Predicted Effect probably benign
Transcript: ENSMUST00000062216
AA Change: A242E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053361
Gene: ENSMUSG00000043969
AA Change: A242E

DomainStartEndE-ValueType
low complexity region 76 109 N/A INTRINSIC
HOX 155 217 1.32e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174573
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous disruption of this gene causes neonatal death, impaired urogenital development and malformation of several forebrain regions. Heterozygotes for a null allele show middle and inner ear defects. Homozygotes for an ENU-induced allele die neonatally with middle ear defects and small kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,145 K785E probably damaging Het
Asap2 G T 12: 21,185,187 A97S probably damaging Het
C1qtnf1 A T 11: 118,443,790 E32V possibly damaging Het
Ccdc81 A G 7: 89,875,873 L500P probably damaging Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
Ceacam5 G A 7: 17,750,695 G454D probably damaging Het
Cemip T C 7: 83,951,440 D991G probably damaging Het
Cep170 A C 1: 176,788,505 I79S probably damaging Het
Cep19 A G 16: 32,107,221 Q149R possibly damaging Het
Cideb A T 14: 55,755,162 L99* probably null Het
Cntnap5a A G 1: 116,428,477 N746S probably benign Het
Col12a1 T C 9: 79,656,798 N1715S probably benign Het
Col3a1 T C 1: 45,321,688 S93P unknown Het
Csmd3 C A 15: 47,585,632 probably null Het
Disp3 T C 4: 148,259,916 I510V probably benign Het
Drosha T A 15: 12,913,984 V1115E probably damaging Het
Dzip3 A C 16: 48,937,006 L888R probably damaging Het
Fto G A 8: 91,441,686 E256K possibly damaging Het
Gabrb2 A C 11: 42,591,888 Y191S possibly damaging Het
Gm6526 A T 14: 43,749,937 H110L probably damaging Het
Grin3b T A 10: 79,974,602 N647K probably damaging Het
Ifit2 T G 19: 34,573,202 S47R probably benign Het
Il5ra A T 6: 106,735,820 V244E possibly damaging Het
Inppl1 A G 7: 101,832,946 L141P probably benign Het
Iws1 A G 18: 32,080,125 D202G probably benign Het
Kctd4 A C 14: 75,963,083 I165L probably benign Het
Lrch3 G A 16: 32,950,376 C116Y probably damaging Het
Mettl25 T C 10: 105,832,983 T93A possibly damaging Het
Mgat4d A G 8: 83,369,037 I314V probably benign Het
Mrgprb4 A T 7: 48,198,411 Y256* probably null Het
Myo9b G T 8: 71,355,764 V1672L probably damaging Het
Nek1 C T 8: 61,049,941 P449L probably benign Het
Nucb2 G A 7: 116,524,407 probably null Het
Obscn T C 11: 59,028,586 Y6864C probably damaging Het
Olfr1179 C T 2: 88,402,433 C167Y probably damaging Het
Olfr131 T A 17: 38,082,595 I128F probably damaging Het
Olfr194 G A 16: 59,119,930 L47F probably damaging Het
Olfr784 A G 10: 129,388,307 K225E probably benign Het
Omt2b A T 9: 78,328,138 probably benign Het
Otogl G T 10: 107,869,526 P647T probably damaging Het
Oxnad1 A G 14: 32,102,287 D271G probably benign Het
Pbx3 T C 2: 34,371,764 I53V probably damaging Het
Pds5b T A 5: 150,716,400 probably null Het
Ppp4r3a A T 12: 101,040,741 D810E probably damaging Het
Ptpro A T 6: 137,461,726 D1189V probably damaging Het
Ryr3 T C 2: 112,661,657 N3758S probably damaging Het
Scarb2 G A 5: 92,446,341 T454M possibly damaging Het
Sec23a A C 12: 58,986,186 probably null Het
Spire2 C T 8: 123,368,763 A535V probably benign Het
Svopl A T 6: 38,029,635 F142L probably benign Het
Tas2r144 T C 6: 42,215,740 I138T probably benign Het
Tbc1d15 A G 10: 115,203,230 M535T probably benign Het
Tnfaip1 C T 11: 78,530,145 V30M possibly damaging Het
Topaz1 T A 9: 122,796,043 W1398R probably damaging Het
Tpo A G 12: 30,084,695 S755P probably damaging Het
Ttn G T 2: 76,776,116 S18116R probably damaging Het
Vmn2r78 A G 7: 86,922,257 probably null Het
Wdr49 T A 3: 75,396,920 K494M probably benign Het
Yeats2 A G 16: 20,206,086 M697V probably damaging Het
Zfp407 G A 18: 84,561,033 P652S possibly damaging Het
Zfp462 A G 4: 55,009,002 M323V probably benign Het
Zfp629 G T 7: 127,610,759 P626Q possibly damaging Het
Zfp804a A T 2: 82,258,188 Y787F probably benign Het
Other mutations in Emx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Emx2 APN 19 59459589 missense possibly damaging 0.83
IGL02103:Emx2 APN 19 59461698 missense probably benign 0.22
R0446:Emx2 UTSW 19 59463916 nonsense probably null
R0631:Emx2 UTSW 19 59464028 missense probably damaging 1.00
R1194:Emx2 UTSW 19 59459552 nonsense probably null
R1512:Emx2 UTSW 19 59459603 missense possibly damaging 0.95
R2019:Emx2 UTSW 19 59459339 missense probably benign
R2066:Emx2 UTSW 19 59461698 missense probably benign 0.01
R2133:Emx2 UTSW 19 59464033 missense probably damaging 0.99
R4977:Emx2 UTSW 19 59459246 missense probably damaging 1.00
R5884:Emx2 UTSW 19 59464029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCCTTGGTAGGGTTTGGAAAGAC -3'
(R):5'- AGCTGCCTCTTTAGACGAGGGTTG -3'

Sequencing Primer
(F):5'- CCTCTGGTATATGATAGGAAGGCAC -3'
(R):5'- TGTCCAAAGTCTGCTGCGAG -3'
Posted On2014-04-13