Incidental Mutation 'R1522:Cntrl'
ID167493
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission 040871-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R1522 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35155279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 781 (I781K)
Ref Sequence ENSEMBL: ENSMUSP00000108657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933]
Predicted Effect probably benign
Transcript: ENSMUST00000028237
AA Change: I1334K

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: I1334K

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113032
AA Change: I1333K

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: I1333K

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113034
AA Change: I781K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110
AA Change: I781K

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113037
AA Change: I780K

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: I780K

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156933
AA Change: I1334K

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: I1334K

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Col11a2 G A 17: 34,055,254 G375S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E219D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Ktn1 A C 14: 47,667,416 K217T probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E717G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Mycbpap A G 11: 94,511,623 probably null Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Nup210 G A 6: 91,069,166 P595L possibly damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L826R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G63D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H87R probably damaging Het
Tlr4 T A 4: 66,839,696 M242K possibly damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L225* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 probably benign Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T38A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Zfp811 A T 17: 32,797,648 Y472N probably damaging Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
PIT4480001:Cntrl UTSW 2 35155428 missense probably damaging 0.96
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1812:Cntrl UTSW 2 35149469 missense probably damaging 0.97
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.04
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.04
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
R7085:Cntrl UTSW 2 35165792 missense probably benign 0.00
R7150:Cntrl UTSW 2 35165445 critical splice acceptor site probably null
R7213:Cntrl UTSW 2 35135680 missense possibly damaging 0.95
R7221:Cntrl UTSW 2 35151857 missense possibly damaging 0.46
R7389:Cntrl UTSW 2 35127517 missense probably benign 0.01
R7414:Cntrl UTSW 2 35165467 missense probably benign 0.02
R7427:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7428:Cntrl UTSW 2 35170534 missense probably benign 0.00
R7453:Cntrl UTSW 2 35155409 missense possibly damaging 0.89
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGTCTCTCCAGCAGTGCATGACTC -3'
(R):5'- AGGCAATGCTGACTGAGAATGTCTG -3'

Sequencing Primer
(F):5'- TAAACAGTTCTCCCGGCG -3'
(R):5'- GCTGACTGAGAATGTCTGTCAAC -3'
Posted On2014-04-13