Incidental Mutation 'R1522:Tlr4'
ID167504
Institutional Source Beutler Lab
Gene Symbol Tlr4
Ensembl Gene ENSMUSG00000039005
Gene Nametoll-like receptor 4
SynonymsRasl2-8, Lps, lipopolysaccharide response
MMRRC Submission 040871-MU
Accession Numbers

MGI: 96824

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1522 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location66827584-66930284 bp(+) (GRCm38)
Type of Mutationmissense (5636 bp from exon)
DNA Base Change (assembly) T to A at 66839696 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 242 (M242K)
Ref Sequence ENSEMBL: ENSMUSP00000045770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]
PDB Structure
Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048096
AA Change: M242K

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: M242K

DomainStartEndE-ValueType
LRR 76 99 7.36e0 SMART
LRR 100 123 1.86e0 SMART
LRR 173 196 8.24e0 SMART
LRR 370 401 4.33e1 SMART
LRR 468 492 2.54e2 SMART
LRR 493 516 1.86e2 SMART
LRR 517 540 1.67e2 SMART
LRR 541 563 1.92e2 SMART
LRRCT 576 626 4.74e-3 SMART
transmembrane domain 636 658 N/A INTRINSIC
TIR 671 816 7.3e-39 SMART
low complexity region 822 833 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107365
SMART Domains Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

DomainStartEndE-ValueType
PDB:3VQ2|B 22 86 2e-38 PDB
SCOP:d1m0za_ 27 86 4e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147008
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Col11a2 G A 17: 34,055,254 G683S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E293D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Ktn1 A C 14: 47,667,416 K217T probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E731G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Mycbpap A G 11: 94,511,623 probably null Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Nup210 G A 6: 91,069,166 P595L possibly damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L827R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G207D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H132R probably damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L237* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 T9509A unknown Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T84A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Zfp811 A T 17: 32,797,648 Y472N probably damaging Het
Other mutations in Tlr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Tlr4 APN 4 66840425 missense probably benign 0.01
IGL01343:Tlr4 APN 4 66833887 unclassified noncoding transcript
IGL01669:Tlr4 APN 4 66841267 missense possibly damaging 0.48
IGL01875:Tlr4 APN 4 66839489 missense probably damaging 1.00
IGL02138:Tlr4 APN 4 66840965 missense probably damaging 0.99
IGL02244:Tlr4 APN 4 66834061 unclassified probably benign
IGL02793:Tlr4 APN 4 66839444 missense probably damaging 1.00
IGL03269:Tlr4 APN 4 66840796 missense probably damaging 1.00
IGL03288:Tlr4 APN 4 66839753 missense probably damaging 0.99
bugsy UTSW 4 66839254 nonsense probably null
cruyff UTSW 4 66840326 missense probably damaging 1.00
don_knotts UTSW 4 66841172 missense probably damaging 1.00
Guardiola UTSW 4 66839303 missense probably damaging 1.00
Lops UTSW 4 66833880 splice acceptor site probably null
lps3 UTSW 4 66841097 missense probably damaging 1.00
Lps4 UTSW 4 66841142 missense probably damaging 1.00
milquetoast UTSW 4 66839444 missense probably damaging 1.00
R0449:Tlr4 UTSW 4 66839620 missense probably damaging 0.99
R0481:Tlr4 UTSW 4 66827916 missense probably benign 0.05
R0576:Tlr4 UTSW 4 66839495 missense probably benign 0.00
R0827:Tlr4 UTSW 4 66833880 splice site probably null
R1488:Tlr4 UTSW 4 66839549 missense probably damaging 1.00
R1490:Tlr4 UTSW 4 66839374 missense possibly damaging 0.56
R1616:Tlr4 UTSW 4 66839480 missense probably damaging 1.00
R1681:Tlr4 UTSW 4 66841105 missense probably damaging 1.00
R1738:Tlr4 UTSW 4 66841076 missense probably benign 0.19
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1888:Tlr4 UTSW 4 66841172 missense probably damaging 1.00
R1929:Tlr4 UTSW 4 66839444 missense probably damaging 1.00
R1982:Tlr4 UTSW 4 66841035 missense probably benign 0.40
R1998:Tlr4 UTSW 4 66840470 missense probably damaging 1.00
R2186:Tlr4 UTSW 4 66839983 missense possibly damaging 0.63
R2305:Tlr4 UTSW 4 66840101 missense probably damaging 1.00
R3011:Tlr4 UTSW 4 66839254 nonsense probably null
R3420:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3422:Tlr4 UTSW 4 66839536 missense probably benign 0.37
R3818:Tlr4 UTSW 4 66841316 missense probably benign 0.00
R4212:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4213:Tlr4 UTSW 4 66840326 missense probably damaging 1.00
R4417:Tlr4 UTSW 4 66839303 missense probably damaging 1.00
R4630:Tlr4 UTSW 4 66839240 missense probably benign 0.44
R4735:Tlr4 UTSW 4 66841198 missense probably damaging 1.00
R5191:Tlr4 UTSW 4 66841379 missense probably damaging 0.96
R5613:Tlr4 UTSW 4 66840885 missense possibly damaging 0.94
R5705:Tlr4 UTSW 4 66833980 missense probably damaging 1.00
R5726:Tlr4 UTSW 4 66840415 missense probably benign
R6021:Tlr4 UTSW 4 66840866 missense probably damaging 1.00
R6159:Tlr4 UTSW 4 66839833 missense possibly damaging 0.92
R6227:Tlr4 UTSW 4 66840595 missense probably benign
X0064:Tlr4 UTSW 4 66840140 missense probably damaging 0.99
Z1088:Tlr4 UTSW 4 66929082 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAAGGCATGGCATGGCTTACAC -3'
(R):5'- GCAGAAACATTCGCCAAGCAATGG -3'

Sequencing Primer
(F):5'- CTCTAGAAAGCTTCCCTATTGGACAG -3'
(R):5'- TTCGCCAAGCAATGGAACTTAAC -3'
Posted OnApr 13, 2014