Incidental Mutation 'R1522:Nup210'
ID167518
Institutional Source Beutler Lab
Gene Symbol Nup210
Ensembl Gene ENSMUSG00000030091
Gene Namenucleoporin 210
Synonymsgp190, Pom210, gp210
MMRRC Submission 040871-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1522 (G1)
Quality Score193
Status Not validated
Chromosome6
Chromosomal Location91013068-91116829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91069166 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 595 (P595L)
Ref Sequence ENSEMBL: ENSMUSP00000032179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032179
AA Change: P595L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: P595L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 3e-29 BLAST
low complexity region 850 862 N/A INTRINSIC
Blast:S1 937 1022 6e-37 BLAST
BID_2 1077 1152 8.36e-6 SMART
low complexity region 1159 1168 N/A INTRINSIC
Blast:BID_2 1468 1551 3e-35 BLAST
transmembrane domain 1809 1831 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113509
AA Change: P595L

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: P595L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 4e-29 BLAST
low complexity region 806 818 N/A INTRINSIC
Blast:S1 893 978 4e-37 BLAST
BID_2 1033 1108 8.36e-6 SMART
low complexity region 1115 1124 N/A INTRINSIC
Blast:BID_2 1424 1507 3e-35 BLAST
transmembrane domain 1765 1787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151437
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Col11a2 G A 17: 34,055,254 G375S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E219D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Ktn1 A C 14: 47,667,416 K217T probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E717G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Mycbpap A G 11: 94,511,623 probably null Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L826R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G63D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H87R probably damaging Het
Tlr4 T A 4: 66,839,696 M242K possibly damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L225* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 probably benign Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T38A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Zfp811 A T 17: 32,797,648 Y472N probably damaging Het
Other mutations in Nup210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nup210 APN 6 91030097 missense possibly damaging 0.92
IGL01532:Nup210 APN 6 91085999 splice site probably benign
IGL01574:Nup210 APN 6 91040564 missense probably benign 0.35
IGL01621:Nup210 APN 6 91030117 missense probably damaging 1.00
IGL01976:Nup210 APN 6 91053614 missense possibly damaging 0.89
IGL02089:Nup210 APN 6 91076698 missense probably benign 0.04
IGL02291:Nup210 APN 6 91101268 missense probably damaging 1.00
IGL03013:Nup210 APN 6 91053379 missense probably benign 0.00
IGL03046:Nup210 APN 6 91018996 splice site probably benign
IGL03136:Nup210 APN 6 91028861 missense probably benign 0.32
IGL03139:Nup210 APN 6 91020239 missense probably benign 0.08
IGL03195:Nup210 APN 6 91015850 missense probably benign 0.32
IGL03344:Nup210 APN 6 91021429 missense possibly damaging 0.53
brotherhood UTSW 6 91036469 missense possibly damaging 0.81
equality UTSW 6 91021395 critical splice donor site probably null
liberty UTSW 6 91020180 missense probably benign 0.04
unity UTSW 6 91031668 nonsense probably null
IGL03134:Nup210 UTSW 6 91030190 missense probably damaging 0.99
PIT4810001:Nup210 UTSW 6 91030124 missense probably damaging 1.00
R0100:Nup210 UTSW 6 91069193 missense probably benign 0.04
R0348:Nup210 UTSW 6 91074310 missense probably benign 0.27
R0385:Nup210 UTSW 6 91028795 missense possibly damaging 0.77
R0551:Nup210 UTSW 6 91021484 missense possibly damaging 0.85
R0606:Nup210 UTSW 6 91026929 missense possibly damaging 0.89
R1053:Nup210 UTSW 6 91028811 missense probably benign 0.41
R1301:Nup210 UTSW 6 91042347 missense possibly damaging 0.47
R1381:Nup210 UTSW 6 91075960 missense probably damaging 0.99
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1487:Nup210 UTSW 6 91042576 missense probably damaging 1.00
R1529:Nup210 UTSW 6 91036376 missense probably damaging 1.00
R1531:Nup210 UTSW 6 91034841 missense probably benign 0.05
R1668:Nup210 UTSW 6 91028805 missense possibly damaging 0.89
R1694:Nup210 UTSW 6 91062803 missense probably benign 0.09
R1803:Nup210 UTSW 6 91074282 missense probably damaging 0.99
R1851:Nup210 UTSW 6 91016054 missense probably damaging 1.00
R2145:Nup210 UTSW 6 91028876 missense possibly damaging 0.81
R2196:Nup210 UTSW 6 91055244 missense probably benign 0.02
R2308:Nup210 UTSW 6 91040868 missense probably benign 0.19
R2419:Nup210 UTSW 6 91017556 splice site probably benign
R2912:Nup210 UTSW 6 91026974 missense probably damaging 1.00
R3413:Nup210 UTSW 6 91025242 missense probably benign 0.00
R3718:Nup210 UTSW 6 91020180 missense probably benign 0.04
R3753:Nup210 UTSW 6 91021395 critical splice donor site probably null
R4058:Nup210 UTSW 6 91060620 missense probably benign 0.02
R4840:Nup210 UTSW 6 91031668 nonsense probably null
R4912:Nup210 UTSW 6 91017529 missense probably benign 0.01
R4967:Nup210 UTSW 6 91036469 missense possibly damaging 0.81
R4996:Nup210 UTSW 6 91053436 missense probably benign 0.16
R5074:Nup210 UTSW 6 91055327 missense probably benign 0.16
R5233:Nup210 UTSW 6 91026969 missense probably damaging 1.00
R5352:Nup210 UTSW 6 91069316 missense probably damaging 1.00
R5490:Nup210 UTSW 6 91085988 missense probably damaging 0.98
R5511:Nup210 UTSW 6 91026963 missense probably damaging 0.97
R5773:Nup210 UTSW 6 91085883 missense probably damaging 0.96
R6064:Nup210 UTSW 6 91055291 missense probably benign 0.01
R6209:Nup210 UTSW 6 91025355 missense probably benign
R6299:Nup210 UTSW 6 91074288 missense possibly damaging 0.68
R6705:Nup210 UTSW 6 91087960 missense possibly damaging 0.50
R6855:Nup210 UTSW 6 91040853 missense probably benign 0.13
R6856:Nup210 UTSW 6 91087913 nonsense probably null
R6911:Nup210 UTSW 6 91030130 missense probably damaging 0.98
R6955:Nup210 UTSW 6 91087927 missense probably damaging 1.00
R7045:Nup210 UTSW 6 91054451 missense probably damaging 1.00
R7081:Nup210 UTSW 6 91060665 missense possibly damaging 0.50
R7163:Nup210 UTSW 6 91073331 missense probably damaging 1.00
R7305:Nup210 UTSW 6 91087966 missense probably damaging 1.00
R7387:Nup210 UTSW 6 91021396 critical splice donor site probably null
R7404:Nup210 UTSW 6 91073245 missense probably benign 0.01
R7469:Nup210 UTSW 6 91018892 missense probably benign 0.08
X0067:Nup210 UTSW 6 91074280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCCACTCAGGCATGGAAGAGAC -3'
(R):5'- CTAGGTGTATGTGATTGAGCCCAGC -3'

Sequencing Primer
(F):5'- GCATGGAAGAGACACTTTGC -3'
(R):5'- AGCAGCATGGAGTTTGCC -3'
Posted On2014-04-13