Incidental Mutation 'R1522:Mycbpap'
ID167547
Institutional Source Beutler Lab
Gene Symbol Mycbpap
Ensembl Gene ENSMUSG00000039110
Gene NameMYCBP associated protein
SynonymsAMAP-1, 4932408B01Rik
MMRRC Submission 040871-MU
Accession Numbers

NCBI RefSeq: NM_170671.2; MGI: 2388726

Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R1522 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location94501347-94521742 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 94511623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040692] [ENSMUST00000093945]
Predicted Effect probably benign
Transcript: ENSMUST00000040692
SMART Domains Protein: ENSMUSP00000047579
Gene: ENSMUSG00000039110

DomainStartEndE-ValueType
Pfam:MYCBPAP 6 85 2.3e-19 PFAM
low complexity region 330 342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093945
SMART Domains Protein: ENSMUSP00000091477
Gene: ENSMUSG00000039110

DomainStartEndE-ValueType
low complexity region 23 36 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:MYCBPAP 184 602 3.7e-144 PFAM
low complexity region 848 860 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151993
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik T C 6: 83,162,586 S498P probably damaging Het
3100002H09Rik A G 4: 124,610,694 W22R probably damaging Het
AA986860 A G 1: 130,743,094 E351G probably damaging Het
Acsl5 T C 19: 55,280,492 V195A probably benign Het
Adamts10 A G 17: 33,537,319 D312G probably benign Het
Adgrb1 A G 15: 74,580,617 M211V probably damaging Het
Ankfy1 C T 11: 72,755,867 R859* probably null Het
Atp8b1 T A 18: 64,550,432 I742L probably benign Het
B3galnt2 T A 13: 13,970,769 V89E probably damaging Het
BC024978 A G 7: 27,202,680 H244R probably damaging Het
Brinp3 A C 1: 146,901,890 T692P probably damaging Het
C9 T A 15: 6,486,762 F349I probably damaging Het
Cacna1a T A 8: 84,633,433 M1976K probably benign Het
Ccdc180 T C 4: 45,927,975 V1170A possibly damaging Het
Celsr1 A G 15: 85,931,276 V1846A probably benign Het
Ces1f A T 8: 93,271,889 Y160N possibly damaging Het
Cfap45 A G 1: 172,540,572 E377G probably damaging Het
Clca3a1 T A 3: 144,755,171 M240L probably benign Het
Clnk G A 5: 38,794,966 T10M probably damaging Het
Cntrl T A 2: 35,155,279 I781K possibly damaging Het
Col11a2 G A 17: 34,055,254 G375S probably damaging Het
Col6a5 T A 9: 105,939,994 I373F unknown Het
Dmxl1 C T 18: 49,852,367 A227V probably benign Het
Dok5 A G 2: 170,732,132 N4D probably benign Het
Dpysl3 A T 18: 43,363,557 V138D probably damaging Het
Efs A T 14: 54,919,715 Y380N probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Farp2 A G 1: 93,618,553 Q855R possibly damaging Het
Fcrls A C 3: 87,256,707 S372A possibly damaging Het
Gadl1 C T 9: 115,944,229 A113V probably damaging Het
Gatsl2 T G 5: 134,125,887 S43R probably damaging Het
Gda T A 19: 21,412,539 E219D probably benign Het
Gli1 A T 10: 127,332,577 M469K probably damaging Het
Gm4847 A T 1: 166,641,650 S148R probably damaging Het
Golga2 T C 2: 32,302,204 V325A probably benign Het
Hpf1 A G 8: 60,896,749 D137G probably damaging Het
Htr2a C G 14: 74,705,853 S291* probably null Het
Itga5 G A 15: 103,356,782 Q233* probably null Het
Jazf1 C A 6: 52,812,183 R102L probably damaging Het
Kif6 T G 17: 49,714,113 L322R probably damaging Het
Ktn1 A C 14: 47,667,416 K217T probably damaging Het
Lig4 A T 8: 9,973,012 V256E possibly damaging Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Lrp1 A T 10: 127,575,286 D1399E probably benign Het
Mmel1 A G 4: 154,894,986 E717G probably damaging Het
Mndal G T 1: 173,871,466 P155H possibly damaging Het
Nedd1 T C 10: 92,719,614 E3G probably damaging Het
Nlgn1 A T 3: 25,435,909 N551K probably damaging Het
Nup210 G A 6: 91,069,166 P595L possibly damaging Het
Olfr117 A T 17: 37,659,770 C188S probably damaging Het
Olfr1302 A T 2: 111,780,348 probably null Het
Olfr199 T G 16: 59,215,984 T210P probably damaging Het
Olfr477 A G 7: 107,990,533 H56R probably benign Het
Olfr697 A G 7: 106,741,005 C310R probably benign Het
Pank3 G A 11: 35,781,681 V304M probably benign Het
Phf3 G A 1: 30,805,648 T1410I probably benign Het
Ppm1k A G 6: 57,525,157 I7T possibly damaging Het
Ppp1r12c T C 7: 4,497,425 D73G probably damaging Het
Prelid2 T G 18: 41,881,267 M165L probably benign Het
Prkd3 A C 17: 78,952,696 L826R probably damaging Het
Ptchd4 A T 17: 42,503,542 N778I probably damaging Het
Ptprm T C 17: 66,693,871 D1063G possibly damaging Het
Rab27a C A 9: 73,075,482 T23N probably damaging Het
Rasgrf2 A T 13: 91,896,086 F949L probably benign Het
Rbm33 A G 5: 28,337,004 N68D probably damaging Het
Rgl1 A T 1: 152,586,533 L109Q probably damaging Het
Rnf20 A G 4: 49,638,197 N103S possibly damaging Het
Sbno1 G A 5: 124,392,612 L875F probably damaging Het
Scube1 T A 15: 83,628,076 probably null Het
Selenbp1 G A 3: 94,937,358 V109M probably damaging Het
Serpina3c T A 12: 104,151,546 I178F probably damaging Het
Shisa8 C T 15: 82,208,501 G63D probably damaging Het
Snx14 T C 9: 88,402,224 R464G possibly damaging Het
Snx25 A T 8: 46,124,082 M1K probably null Het
Sorcs3 C A 19: 48,706,009 T574K possibly damaging Het
Syne2 A G 12: 76,103,783 E6528G probably damaging Het
Syt5 T C 7: 4,540,246 E338G probably damaging Het
Tbk1 T C 10: 121,551,318 K691E probably benign Het
Tenm3 G A 8: 48,395,576 T11I probably damaging Het
Thrb A G 14: 18,002,597 H87R probably damaging Het
Tlr4 T A 4: 66,839,696 M242K possibly damaging Het
Tm4sf19 T C 16: 32,406,002 M56T possibly damaging Het
Tmem212 T A 3: 27,886,471 R66* probably null Het
Tmem39b G T 4: 129,684,482 D315E probably benign Het
Tnxb T C 17: 34,718,638 F3834L probably damaging Het
Trim36 A T 18: 46,186,183 L225* probably null Het
Trim42 A T 9: 97,365,679 H321Q probably damaging Het
Trio G T 15: 27,732,640 Q3052K probably benign Het
Trpm3 T C 19: 22,978,334 I1091T probably benign Het
Tst T C 15: 78,399,943 E228G possibly damaging Het
Ttn T C 2: 76,871,716 probably benign Het
Uap1 A C 1: 170,150,941 probably null Het
Ush2a T C 1: 188,797,814 S3267P possibly damaging Het
Usp5 T C 6: 124,825,166 T38A probably benign Het
Uvssa A T 5: 33,387,808 Q84L probably damaging Het
Vmn1r159 T G 7: 22,843,268 H113P probably damaging Het
Vps13d A T 4: 145,098,172 probably null Het
Zfp182 T A X: 21,031,560 I166L probably benign Het
Zfp811 A T 17: 32,797,648 Y472N probably damaging Het
Other mutations in Mycbpap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Mycbpap APN 11 94509319 unclassified probably null
IGL01372:Mycbpap APN 11 94506456 missense possibly damaging 0.56
IGL01627:Mycbpap APN 11 94514604 missense probably damaging 0.98
IGL01645:Mycbpap APN 11 94503467 splice site probably null
IGL01712:Mycbpap APN 11 94512655 missense possibly damaging 0.50
IGL02209:Mycbpap APN 11 94509882 splice site probably benign
IGL02377:Mycbpap APN 11 94503250 missense probably damaging 1.00
IGL03088:Mycbpap APN 11 94513943 critical splice acceptor site probably null
IGL03412:Mycbpap APN 11 94508101 splice site probably null
IGL03046:Mycbpap UTSW 11 94505717 missense possibly damaging 0.84
P0008:Mycbpap UTSW 11 94504067 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0053:Mycbpap UTSW 11 94511736 missense probably damaging 1.00
R0437:Mycbpap UTSW 11 94513512 splice site probably benign
R0706:Mycbpap UTSW 11 94513786 nonsense probably null
R0791:Mycbpap UTSW 11 94511623 critical splice donor site probably null
R1496:Mycbpap UTSW 11 94505561 missense probably benign 0.11
R1698:Mycbpap UTSW 11 94508143 nonsense probably null
R1796:Mycbpap UTSW 11 94507551 missense probably damaging 1.00
R1906:Mycbpap UTSW 11 94505621 missense probably benign 0.24
R4115:Mycbpap UTSW 11 94512225 splice site probably null
R4930:Mycbpap UTSW 11 94503157 missense probably benign 0.20
R4965:Mycbpap UTSW 11 94504938 missense probably damaging 1.00
R5323:Mycbpap UTSW 11 94503504 missense probably benign 0.00
R5326:Mycbpap UTSW 11 94507746 splice site probably null
R5542:Mycbpap UTSW 11 94507746 splice site probably null
R5625:Mycbpap UTSW 11 94505693 missense probably damaging 0.99
R5841:Mycbpap UTSW 11 94505610 missense probably damaging 1.00
R5996:Mycbpap UTSW 11 94513594 missense probably benign
R6065:Mycbpap UTSW 11 94508187 unclassified probably null
R6192:Mycbpap UTSW 11 94507731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGCACTAGGCACAAGGAGCTAA -3'
(R):5'- GTGACCTCACTGCTCTGTCCTCA -3'

Sequencing Primer
(F):5'- tcatagaaacaccaccaaagaac -3'
(R):5'- ACTGCTCTGTCCTCATCTTGAC -3'
Posted On2014-04-13