Incidental Mutation 'R1523:Arhgap32'
ID167641
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1523 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32256752 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 677 (V677D)
Ref Sequence ENSEMBL: ENSMUSP00000138145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]
Predicted Effect probably damaging
Transcript: ENSMUST00000168954
AA Change: V677D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: V677D

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174641
AA Change: V1026D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: V1026D

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182802
AA Change: V677D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: V677D

DomainStartEndE-ValueType
RhoGAP 34 215 9.6e-60 SMART
Blast:RhoGAP 232 298 7e-31 BLAST
low complexity region 518 533 N/A INTRINSIC
low complexity region 669 689 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 960 974 N/A INTRINSIC
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1076 1093 N/A INTRINSIC
low complexity region 1304 1317 N/A INTRINSIC
low complexity region 1691 1700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
4930503B20Rik A G 3: 146,651,109 S15P probably damaging Het
4933402E13Rik T A X: 62,290,906 D177E probably benign Het
5530400C23Rik A G 6: 133,294,293 E100G possibly damaging Het
Abcg2 T C 6: 58,685,694 F507S possibly damaging Het
Adgrf5 A T 17: 43,450,153 Q913L probably benign Het
Ak7 A T 12: 105,766,608 N537I probably benign Het
Anks1 T A 17: 28,051,655 probably null Het
Arnt C T 3: 95,489,654 P466L possibly damaging Het
Arrb1 T G 7: 99,594,665 L274R probably damaging Het
Atf2 A T 2: 73,863,208 D3E probably damaging Het
Baz2b C T 2: 59,968,637 R381Q possibly damaging Het
Cacna1g C T 11: 94,442,729 probably null Het
Ccr10 C T 11: 101,173,675 R343Q probably damaging Het
Clca2 G T 3: 145,071,644 S822* probably null Het
Col12a1 A T 9: 79,660,996 Y1649N probably benign Het
Col23a1 G A 11: 51,561,916 probably null Het
Cp T C 3: 19,989,065 Y1006H probably benign Het
Ctbs A G 3: 146,454,980 T101A probably benign Het
Cyp4a31 T C 4: 115,569,754 F170L probably benign Het
Dock1 A C 7: 134,744,247 I173L possibly damaging Het
Dock4 A G 12: 40,693,025 D393G possibly damaging Het
Dsg1a T A 18: 20,322,317 S113T probably damaging Het
Epha3 T C 16: 63,610,948 D530G probably damaging Het
Erbb4 T A 1: 68,396,252 H162L possibly damaging Het
Fam131c C T 4: 141,382,831 T180I probably benign Het
Fndc1 A G 17: 7,773,209 S552P unknown Het
Foxf1 A G 8: 121,084,558 probably null Het
Frem2 T C 3: 53,655,407 T560A possibly damaging Het
Gabra4 G A 5: 71,633,632 T289M probably damaging Het
Gcnt1 A G 19: 17,329,833 V176A probably damaging Het
Gemin8 G A X: 166,180,648 S100N probably benign Het
Gm1527 T C 3: 28,920,418 I460T probably damaging Het
Gm6729 A G 10: 86,540,175 noncoding transcript Het
Gprin2 T C 14: 34,195,079 S245G probably benign Het
Gsdmc A T 15: 63,803,630 I112N probably damaging Het
Hspb6 A G 7: 30,553,423 D30G probably benign Het
Hydin A G 8: 110,533,271 D2625G probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf2 T A 8: 46,837,840 probably null Het
Kdm3b T C 18: 34,793,173 probably null Het
Khdc3 G A 9: 73,103,491 E208K possibly damaging Het
Kifc1 A T 17: 33,883,662 S263T probably benign Het
Lrig3 C A 10: 126,008,698 T677K probably damaging Het
Mapkapk3 A T 9: 107,263,623 probably null Het
Mertk T C 2: 128,790,328 probably null Het
Metrn A G 17: 25,794,977 *292R probably null Het
Mllt6 G T 11: 97,665,023 A60S probably damaging Het
Mmp21 T C 7: 133,679,045 I65M probably benign Het
Myo7b A G 18: 31,966,876 L1651P probably damaging Het
Nhsl1 A G 10: 18,408,355 S15G probably benign Het
Nos1ap T C 1: 170,338,118 D192G probably benign Het
Nrcam A G 12: 44,572,249 T844A probably damaging Het
Pax4 A G 6: 28,444,841 L203P probably damaging Het
Pbld2 T C 10: 63,076,433 I280T probably benign Het
Pclo A G 5: 14,788,406 Y4681C unknown Het
Phyhip T A 14: 70,461,760 M1K probably null Het
Plppr4 T C 3: 117,322,841 N456D probably damaging Het
Prpf31 T C 7: 3,640,857 Y473H probably damaging Het
Rapgef2 A T 3: 79,092,749 V564D probably damaging Het
Rexo1 T C 10: 80,542,751 S1123G probably benign Het
Rnasel C A 1: 153,756,013 Q513K probably damaging Het
Rnf165 G A 18: 77,462,938 T98I probably benign Het
Rnf213 T C 11: 119,441,888 V2641A probably damaging Het
Rnf40 G T 7: 127,590,615 R184L probably damaging Het
Rnf8 A G 17: 29,626,972 K179R probably damaging Het
Sipa1l2 C T 8: 125,447,613 D1309N possibly damaging Het
Slc25a38 T A 9: 120,123,703 M307K possibly damaging Het
Snx33 T C 9: 56,926,182 D201G possibly damaging Het
Sulf1 T A 1: 12,817,350 Y249* probably null Het
Sult2a4 G A 7: 13,909,860 Q261* probably null Het
Syndig1 G A 2: 150,003,234 A226T probably damaging Het
Tcaf2 C T 6: 42,624,451 W891* probably null Het
Tcf15 C A 2: 152,143,888 T88K probably damaging Het
Tmem19 A T 10: 115,347,217 M117K probably damaging Het
Trim32 T C 4: 65,614,004 L266P probably benign Het
Vmn2r11 T C 5: 109,053,841 I266V probably benign Het
Vmn2r73 A T 7: 85,870,278 Y491N probably benign Het
Wrn C T 8: 33,292,716 E486K probably benign Het
Zfp457 T C 13: 67,293,437 E262G probably damaging Het
Zfp598 A G 17: 24,678,629 D308G probably null Het
Zufsp T C 10: 33,927,440 I549M probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0508:Arhgap32 UTSW 9 32190068 splice site probably benign
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTGGCAGCCTTTAACACTGTG -3'
(R):5'- GCAGCTTCTCTTCAGATGGAACGAC -3'

Sequencing Primer
(F):5'- CAACCAGATGTGGTTTCAGC -3'
(R):5'- TTCAGATGGAACGACTGCCG -3'
Posted On2014-04-13