Incidental Mutation 'R1523:Zfp598'
ID167671
Institutional Source Beutler Lab
Gene Symbol Zfp598
Ensembl Gene ENSMUSG00000041130
Gene Namezinc finger protein 598
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.972) question?
Stock #R1523 (G1)
Quality Score148
Status Not validated
Chromosome17
Chromosomal Location24669752-24682015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24678629 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 308 (D308G)
Ref Sequence ENSEMBL: ENSMUSP00000038367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047179]
Predicted Effect probably null
Transcript: ENSMUST00000047179
AA Change: D308G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038367
Gene: ENSMUSG00000041130
AA Change: D308G

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
RING 27 66 4.73e-1 SMART
ZnF_C2H2 115 140 9.46e0 SMART
low complexity region 144 153 N/A INTRINSIC
ZnF_C2H2 185 208 5.2e0 SMART
ZnF_C2H2 209 237 7.11e0 SMART
ZnF_C2H2 238 268 6.47e1 SMART
low complexity region 311 331 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
low complexity region 526 544 N/A INTRINSIC
low complexity region 581 589 N/A INTRINSIC
low complexity region 645 663 N/A INTRINSIC
low complexity region 668 683 N/A INTRINSIC
low complexity region 694 748 N/A INTRINSIC
ZnF_C2H2 869 890 8.84e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This protein and Grb10-interacting GYF protein 2 have been identified as a components of the mammalian 4EHP (m4EHP) complex. The complex is thought to function as a translation repressor in embryonic development. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik G T 11: 83,440,406 E48* probably null Het
4930503B20Rik A G 3: 146,651,109 S15P probably damaging Het
4933402E13Rik T A X: 62,290,906 D177E probably benign Het
5530400C23Rik A G 6: 133,294,293 E100G possibly damaging Het
Abcg2 T C 6: 58,685,694 F507S possibly damaging Het
Adgrf5 A T 17: 43,450,153 Q913L probably benign Het
Ak7 A T 12: 105,766,608 N537I probably benign Het
Anks1 T A 17: 28,051,655 probably null Het
Arhgap32 T A 9: 32,256,752 V677D probably damaging Het
Arnt C T 3: 95,489,654 P466L possibly damaging Het
Arrb1 T G 7: 99,594,665 L274R probably damaging Het
Atf2 A T 2: 73,863,208 D3E probably damaging Het
Baz2b C T 2: 59,968,637 R381Q possibly damaging Het
Cacna1g C T 11: 94,442,729 probably null Het
Ccr10 C T 11: 101,173,675 R343Q probably damaging Het
Clca2 G T 3: 145,071,644 S822* probably null Het
Col12a1 A T 9: 79,660,996 Y1649N probably benign Het
Col23a1 G A 11: 51,561,916 probably null Het
Cp T C 3: 19,989,065 Y1006H probably benign Het
Ctbs A G 3: 146,454,980 T101A probably benign Het
Cyp4a31 T C 4: 115,569,754 F170L probably benign Het
Dock1 A C 7: 134,744,247 I173L possibly damaging Het
Dock4 A G 12: 40,693,025 D393G possibly damaging Het
Dsg1a T A 18: 20,322,317 S113T probably damaging Het
Epha3 T C 16: 63,610,948 D530G probably damaging Het
Erbb4 T A 1: 68,396,252 H162L possibly damaging Het
Fam131c C T 4: 141,382,831 T180I probably benign Het
Fndc1 A G 17: 7,773,209 S552P unknown Het
Foxf1 A G 8: 121,084,558 probably null Het
Frem2 T C 3: 53,655,407 T560A possibly damaging Het
Gabra4 G A 5: 71,633,632 T289M probably damaging Het
Gcnt1 A G 19: 17,329,833 V176A probably damaging Het
Gemin8 G A X: 166,180,648 S100N probably benign Het
Gm1527 T C 3: 28,920,418 I460T probably damaging Het
Gm6729 A G 10: 86,540,175 noncoding transcript Het
Gprin2 T C 14: 34,195,079 S245G probably benign Het
Gsdmc A T 15: 63,803,630 I112N probably damaging Het
Hspb6 A G 7: 30,553,423 D30G probably benign Het
Hydin A G 8: 110,533,271 D2625G probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Irf2 T A 8: 46,837,840 probably null Het
Kdm3b T C 18: 34,793,173 probably null Het
Khdc3 G A 9: 73,103,491 E208K possibly damaging Het
Kifc1 A T 17: 33,883,662 S263T probably benign Het
Lrig3 C A 10: 126,008,698 T677K probably damaging Het
Mapkapk3 A T 9: 107,263,623 probably null Het
Mertk T C 2: 128,790,328 probably null Het
Metrn A G 17: 25,794,977 *292R probably null Het
Mllt6 G T 11: 97,665,023 A60S probably damaging Het
Mmp21 T C 7: 133,679,045 I65M probably benign Het
Myo7b A G 18: 31,966,876 L1651P probably damaging Het
Nhsl1 A G 10: 18,408,355 S15G probably benign Het
Nos1ap T C 1: 170,338,118 D192G probably benign Het
Nrcam A G 12: 44,572,249 T844A probably damaging Het
Pax4 A G 6: 28,444,841 L203P probably damaging Het
Pbld2 T C 10: 63,076,433 I280T probably benign Het
Pclo A G 5: 14,788,406 Y4681C unknown Het
Phyhip T A 14: 70,461,760 M1K probably null Het
Plppr4 T C 3: 117,322,841 N456D probably damaging Het
Prpf31 T C 7: 3,640,857 Y473H probably damaging Het
Rapgef2 A T 3: 79,092,749 V564D probably damaging Het
Rexo1 T C 10: 80,542,751 S1123G probably benign Het
Rnasel C A 1: 153,756,013 Q513K probably damaging Het
Rnf165 G A 18: 77,462,938 T98I probably benign Het
Rnf213 T C 11: 119,441,888 V2641A probably damaging Het
Rnf40 G T 7: 127,590,615 R184L probably damaging Het
Rnf8 A G 17: 29,626,972 K179R probably damaging Het
Sipa1l2 C T 8: 125,447,613 D1309N possibly damaging Het
Slc25a38 T A 9: 120,123,703 M307K possibly damaging Het
Snx33 T C 9: 56,926,182 D201G possibly damaging Het
Sulf1 T A 1: 12,817,350 Y249* probably null Het
Sult2a4 G A 7: 13,909,860 Q261* probably null Het
Syndig1 G A 2: 150,003,234 A226T probably damaging Het
Tcaf2 C T 6: 42,624,451 W891* probably null Het
Tcf15 C A 2: 152,143,888 T88K probably damaging Het
Tmem19 A T 10: 115,347,217 M117K probably damaging Het
Trim32 T C 4: 65,614,004 L266P probably benign Het
Vmn2r11 T C 5: 109,053,841 I266V probably benign Het
Vmn2r73 A T 7: 85,870,278 Y491N probably benign Het
Wrn C T 8: 33,292,716 E486K probably benign Het
Zfp457 T C 13: 67,293,437 E262G probably damaging Het
Zufsp T C 10: 33,927,440 I549M probably damaging Het
Other mutations in Zfp598
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Zfp598 APN 17 24681424 unclassified probably benign
IGL02118:Zfp598 APN 17 24677617 missense probably damaging 1.00
IGL02178:Zfp598 APN 17 24677543 missense probably damaging 1.00
IGL02591:Zfp598 APN 17 24677504 missense probably damaging 1.00
IGL03061:Zfp598 APN 17 24679592 missense probably benign 0.03
FR4304:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4340:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4340:Zfp598 UTSW 17 24680783 small insertion probably benign
FR4342:Zfp598 UTSW 17 24680780 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4449:Zfp598 UTSW 17 24680785 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680775 small insertion probably benign
FR4548:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4589:Zfp598 UTSW 17 24680779 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680776 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680782 small insertion probably benign
FR4737:Zfp598 UTSW 17 24680791 small insertion probably benign
FR4976:Zfp598 UTSW 17 24679372 small deletion probably benign
FR4976:Zfp598 UTSW 17 24680782 small insertion probably benign
R0309:Zfp598 UTSW 17 24678584 splice site probably benign
R1295:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1296:Zfp598 UTSW 17 24679649 missense probably benign 0.00
R1471:Zfp598 UTSW 17 24680072 missense probably benign 0.00
R1819:Zfp598 UTSW 17 24681130 unclassified probably benign
R2001:Zfp598 UTSW 17 24669924 missense possibly damaging 0.94
R2080:Zfp598 UTSW 17 24679667 missense probably damaging 1.00
R4447:Zfp598 UTSW 17 24676555 missense probably damaging 1.00
R5086:Zfp598 UTSW 17 24680898 unclassified probably benign
R5923:Zfp598 UTSW 17 24677549 missense probably damaging 1.00
R6191:Zfp598 UTSW 17 24677876 missense possibly damaging 0.89
R6680:Zfp598 UTSW 17 24678686 missense probably benign 0.06
Z1088:Zfp598 UTSW 17 24680210 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ACCCTTGTGGATCGTAAGCTGTTG -3'
(R):5'- TGGCAAAACTGTGCTCTGCTCTC -3'

Sequencing Primer
(F):5'- TTGGGGGTGGAGAAGCC -3'
(R):5'- TACTTGCTGGGCAAACACTG -3'
Posted On2014-04-13