Incidental Mutation 'R1524:Fut7'
ID167691
Institutional Source Beutler Lab
Gene Symbol Fut7
Ensembl Gene ENSMUSG00000036587
Gene Namefucosyltransferase 7
SynonymsFTVII, FucT-VII, Fuc-TVII
MMRRC Submission 039565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25423267-25426374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25425147 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000123526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041654] [ENSMUST00000100320] [ENSMUST00000102919] [ENSMUST00000114278] [ENSMUST00000134259]
Predicted Effect probably damaging
Transcript: ENSMUST00000041654
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039985
Gene: ENSMUSG00000036587
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 10 341 5.1e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100320
AA Change: V139A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097895
Gene: ENSMUSG00000036587
AA Change: V139A

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
Pfam:Glyco_tran_10_N 91 201 8.8e-37 PFAM
Pfam:Glyco_transf_10 216 387 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102919
SMART Domains Protein: ENSMUSP00000099983
Gene: ENSMUSG00000026944

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
coiled coil region 271 296 N/A INTRINSIC
low complexity region 309 346 N/A INTRINSIC
Pfam:ABC2_membrane_3 493 911 9.7e-18 PFAM
AAA 1015 1197 9.22e-7 SMART
low complexity region 1364 1376 N/A INTRINSIC
low complexity region 1589 1607 N/A INTRINSIC
Pfam:ABC2_membrane_3 1696 2008 2.3e-44 PFAM
AAA 2079 2264 1.12e-5 SMART
low complexity region 2375 2394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114278
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109917
Gene: ENSMUSG00000036587
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 10 341 5.1e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134259
AA Change: V92A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123526
Gene: ENSMUSG00000036587
AA Change: V92A

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 9 104 2.3e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142156
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of sialyl-Lewis X antigens. The encoded protein can direct the synthesis of the E-selectin-binding sialyl-Lewis X moiety. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are superficially normal. However, abnormalities are found in immune cell function and lymph node morphology. Redeuced tumor metastasis is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Fut7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Fut7 APN 2 25425331 nonsense probably null
IGL02483:Fut7 APN 2 25423876 missense possibly damaging 0.47
IGL02967:Fut7 APN 2 25425143 missense probably damaging 1.00
IGL03180:Fut7 APN 2 25425453 missense possibly damaging 0.79
R1968:Fut7 UTSW 2 25425726 missense probably benign 0.16
R2115:Fut7 UTSW 2 25425331 nonsense probably null
R2900:Fut7 UTSW 2 25423911 missense probably benign
R4448:Fut7 UTSW 2 25424939 missense probably benign 0.06
R7019:Fut7 UTSW 2 25425780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGACAATTCCAGAAGGCTCCAG -3'
(R):5'- AGCTCAGCACCCAGTTGAAGATG -3'

Sequencing Primer
(F):5'- TTCCAGAAGGCTCCAGATGAATTG -3'
(R):5'- TTGAAGATGCCCCGGAAGC -3'
Posted On2014-04-13