Incidental Mutation 'R1524:Cldn19'
ID167699
Institutional Source Beutler Lab
Gene Symbol Cldn19
Ensembl Gene ENSMUSG00000066058
Gene Nameclaudin 19
Synonyms
MMRRC Submission 039565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location119255414-119262438 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 119257051 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084309] [ENSMUST00000094823]
Predicted Effect probably null
Transcript: ENSMUST00000084309
SMART Domains Protein: ENSMUSP00000081334
Gene: ENSMUSG00000066058

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 5.8e-45 PFAM
Pfam:Claudin_2 15 184 1.1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094823
SMART Domains Protein: ENSMUSP00000092418
Gene: ENSMUSG00000066058

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 6.1e-43 PFAM
Pfam:Claudin_2 15 184 2.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150252
Meta Mutation Damage Score 0.71 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. siRNA knockdown of this gene in mice develops the FHHNC (familial hypomagnesemia with hypercalciuria and nephrocalcinosis) symptoms of chronic renal wasting of magnesium and calcium together with defective renal salt handling. The protein encoded by this gene interacts with another family member, Claudin 16, and their interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. This protein is a constituent of tight junctions in the Schwann cells of peripheral myelinated nerves and the gene deficiency affects the nerve conduction of peripheral myelinated fibers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a peripheral neuropathy associated with significant behavioral abnormalities, a complete lack of tight junctions from myelinated Schwann cells, and abnormal nerve conduction parameters of peripheral myelinated fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Cldn19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Cldn19 APN 4 119255724 nonsense probably null
R1459:Cldn19 UTSW 4 119255613 missense probably damaging 1.00
R1828:Cldn19 UTSW 4 119255793 missense probably benign 0.00
R3008:Cldn19 UTSW 4 119255790 missense probably damaging 1.00
R3709:Cldn19 UTSW 4 119256897 missense possibly damaging 0.70
R3877:Cldn19 UTSW 4 119256897 missense possibly damaging 0.70
R4840:Cldn19 UTSW 4 119255754 missense probably damaging 1.00
R5238:Cldn19 UTSW 4 119255733 missense probably damaging 1.00
R5629:Cldn19 UTSW 4 119256919 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGGTCATATCCAGTCAGCACGAG -3'
(R):5'- AGTCACAAGTGATCCAGGTCACCC -3'

Sequencing Primer
(F):5'- TCAGCACGAGCCCTGATG -3'
(R):5'- GGAGTTAGACTTCAGACTTCACG -3'
Posted On2014-04-13