Incidental Mutation 'R1524:2310003L06Rik'
ID167705
Institutional Source Beutler Lab
Gene Symbol 2310003L06Rik
Ensembl Gene ENSMUSG00000007457
Gene NameRIKEN cDNA 2310003L06 gene
Synonyms
MMRRC Submission 039565-MU
Accession Numbers

Genbank: AK009122; MGI: 1921498

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87969459-87972870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87971689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 102 (V102L)
Ref Sequence ENSEMBL: ENSMUSP00000007601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007601] [ENSMUST00000187738]
Predicted Effect probably benign
Transcript: ENSMUST00000007601
AA Change: V102L

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000007601
Gene: ENSMUSG00000007457
AA Change: V102L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in 2310003L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:2310003L06Rik APN 5 87972790 missense probably benign 0.37
IGL01938:2310003L06Rik APN 5 87971708 missense probably damaging 0.99
IGL03032:2310003L06Rik APN 5 87971915 missense possibly damaging 0.94
D3080:2310003L06Rik UTSW 5 87971987 missense possibly damaging 0.53
IGL02984:2310003L06Rik UTSW 5 87972803 missense probably damaging 0.97
R0359:2310003L06Rik UTSW 5 87964596 unclassified probably benign
R0676:2310003L06Rik UTSW 5 87964657 unclassified probably benign
R1536:2310003L06Rik UTSW 5 87970665 missense probably benign
R1998:2310003L06Rik UTSW 5 87970694 missense probably damaging 0.98
R2080:2310003L06Rik UTSW 5 87971933 missense probably damaging 1.00
R2132:2310003L06Rik UTSW 5 87964476 unclassified probably benign
R2177:2310003L06Rik UTSW 5 87972453 missense probably damaging 0.98
R2399:2310003L06Rik UTSW 5 87972479 missense probably damaging 0.98
R3748:2310003L06Rik UTSW 5 87964563 unclassified probably benign
R4010:2310003L06Rik UTSW 5 87972277 missense probably damaging 0.96
R4096:2310003L06Rik UTSW 5 87972149 missense possibly damaging 0.57
R4656:2310003L06Rik UTSW 5 87964675 unclassified probably benign
R4823:2310003L06Rik UTSW 5 87972598 missense probably benign 0.00
R5753:2310003L06Rik UTSW 5 87972515 missense probably damaging 0.99
R6087:2310003L06Rik UTSW 5 87971762 missense possibly damaging 0.94
R6931:2310003L06Rik UTSW 5 87970702 missense probably damaging 0.97
R7032:2310003L06Rik UTSW 5 87972579 missense possibly damaging 0.79
Z1088:2310003L06Rik UTSW 5 87972306 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CGGCAAGTAATCCTTCATCCACCAG -3'
(R):5'- GTGAGGAGTATCAGCGGGTTCAAAC -3'

Sequencing Primer
(F):5'- GTAATCCTTCATCCACCAGAAAAAC -3'
(R):5'- CTGGTAGTAGGTCACTGACAC -3'
Posted On2014-04-13