Incidental Mutation 'R1525:Ints9'
ID167809
Institutional Source Beutler Lab
Gene Symbol Ints9
Ensembl Gene ENSMUSG00000021975
Gene Nameintegrator complex subunit 9
SynonymsD14Ertd231e
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1525 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location64950045-65039832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64995011 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 173 (I173T)
Ref Sequence ENSEMBL: ENSMUSP00000045552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043914]
Predicted Effect probably benign
Transcript: ENSMUST00000043914
AA Change: I173T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000045552
Gene: ENSMUSG00000021975
AA Change: I173T

DomainStartEndE-ValueType
Pfam:Lactamase_B_6 91 289 1.2e-17 PFAM
Beta-Casp 334 462 7.65e-16 SMART
low complexity region 583 596 N/A INTRINSIC
low complexity region 672 682 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225790
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the Integrator complex. This protein complex binds the C-terminal domain of RNA polymerase II and likely plays a role in small nuclear RNA processing. The encoded protein has similarities to the subunits of the cleavage and polyadenylation specificity factor complex. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Cyp2d11 G T 15: 82,389,297 L458I probably damaging Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mep1a T C 17: 43,491,636 Q166R probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr1188 C G 2: 88,559,641 S57R probably damaging Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Olfr720 T A 14: 14,175,725 Y119F probably damaging Het
Pdilt T A 7: 119,487,994 T478S probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Ranbp3 A G 17: 56,710,865 D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Ints9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ints9 APN 14 65037421 missense probably benign 0.00
IGL02374:Ints9 APN 14 65039333 missense probably benign 0.00
IGL02728:Ints9 APN 14 64993008 missense probably damaging 1.00
IGL02992:Ints9 APN 14 64980164 missense probably benign 0.08
IGL03151:Ints9 APN 14 65032340 missense possibly damaging 0.86
R0437:Ints9 UTSW 14 64986369 splice site probably benign
R0582:Ints9 UTSW 14 64980149 missense probably damaging 1.00
R1569:Ints9 UTSW 14 64980122 missense possibly damaging 0.91
R1835:Ints9 UTSW 14 65032256 missense probably damaging 1.00
R1839:Ints9 UTSW 14 65016530 missense probably damaging 1.00
R1862:Ints9 UTSW 14 65026413 missense probably benign
R1892:Ints9 UTSW 14 65020423 missense probably benign 0.08
R2146:Ints9 UTSW 14 64986343 missense possibly damaging 0.71
R2285:Ints9 UTSW 14 65007997 missense possibly damaging 0.61
R3015:Ints9 UTSW 14 64950278 missense probably benign 0.00
R4133:Ints9 UTSW 14 64990554 missense probably benign
R4180:Ints9 UTSW 14 64992981 missense probably damaging 1.00
R4509:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4510:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4511:Ints9 UTSW 14 65028932 missense possibly damaging 0.96
R4608:Ints9 UTSW 14 65032280 missense possibly damaging 0.82
R5023:Ints9 UTSW 14 64980228 missense probably damaging 1.00
R5117:Ints9 UTSW 14 64993091 nonsense probably null
R5261:Ints9 UTSW 14 65008072 missense probably benign 0.25
R5582:Ints9 UTSW 14 65028896 missense possibly damaging 0.83
R5990:Ints9 UTSW 14 65039328 missense probably damaging 1.00
R6009:Ints9 UTSW 14 65008082 missense probably benign 0.43
R6241:Ints9 UTSW 14 64980210 missense possibly damaging 0.90
R6351:Ints9 UTSW 14 64993007 missense probably damaging 0.98
R6821:Ints9 UTSW 14 65037458 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GAATGGCAGAGGTCTGTCTCACTG -3'
(R):5'- TGAGTGACCTGGACCATTAGACCC -3'

Sequencing Primer
(F):5'- atgccccctctcccgtc -3'
(R):5'- AGCCAGGTGCTCCCAAAG -3'
Posted On2014-04-13