Incidental Mutation 'R1510:Rcn1'
ID167827
Institutional Source Beutler Lab
Gene Symbol Rcn1
Ensembl Gene ENSMUSG00000005973
Gene Namereticulocalbin 1
SynonymsRcn
MMRRC Submission 039557-MU
Accession Numbers

Ncbi RefSeq: NM_009037.2; MGI:104559

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location105386291-105399319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105389089 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 253 (N253S)
Ref Sequence ENSEMBL: ENSMUSP00000006128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006128]
Predicted Effect probably damaging
Transcript: ENSMUST00000006128
AA Change: N253S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006128
Gene: ENSMUSG00000005973
AA Change: N253S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EFh 77 105 1.45e0 SMART
EFh 113 141 6.56e0 SMART
Blast:EFh 164 192 3e-9 BLAST
EFh 201 229 4.35e-2 SMART
Pfam:EF-hand_5 244 267 1.6e-4 PFAM
Blast:EFh 278 306 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127019
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Reticulocalbin 1 is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. High conservation of amino acid residues outside of these motifs, in comparison to mouse reticulocalbin, is consistent with a possible biochemical function besides that of calcium binding. In human endothelial and prostate cancer cell lines this protein localizes to the plasma membrane.[provided by RefSeq, Jan 2009]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Rcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Rcn1 APN 2 105394829 missense possibly damaging 0.83
IGL02347:Rcn1 APN 2 105399126 missense probably benign 0.17
P0031:Rcn1 UTSW 2 105389069 nonsense probably null
R0107:Rcn1 UTSW 2 105394781 missense possibly damaging 0.79
R1699:Rcn1 UTSW 2 105399005 missense probably damaging 1.00
R4027:Rcn1 UTSW 2 105399050 nonsense probably null
R4028:Rcn1 UTSW 2 105399050 nonsense probably null
R4029:Rcn1 UTSW 2 105399050 nonsense probably null
R4923:Rcn1 UTSW 2 105389173 missense probably benign 0.06
R4956:Rcn1 UTSW 2 105394776 nonsense probably null
R5079:Rcn1 UTSW 2 105399057 missense probably damaging 0.96
R5333:Rcn1 UTSW 2 105389126 missense probably benign 0.00
R5709:Rcn1 UTSW 2 105394783 missense probably damaging 1.00
R6160:Rcn1 UTSW 2 105392017 missense probably damaging 1.00
R6525:Rcn1 UTSW 2 105388975 critical splice donor site probably null
R7111:Rcn1 UTSW 2 105389014 missense probably damaging 1.00
R7388:Rcn1 UTSW 2 105391991 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTGCTGACAAGGCCCACAAAC -3'
(R):5'- GCTCTGCACCAATGCCACTTAGTTC -3'

Sequencing Primer
(F):5'- GGCCCACAAACCCTATCTTG -3'
(R):5'- ATGGGCTGTCACCCTTGC -3'
Posted On2014-04-13