Incidental Mutation 'R1510:Olfr480'
ID167848
Institutional Source Beutler Lab
Gene Symbol Olfr480
Ensembl Gene ENSMUSG00000063120
Gene Nameolfactory receptor 480
SynonymsGA_x6K02T2PBJ9-10395807-10394869, MOR204-32
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108064878-108067346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108066528 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000149301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071658] [ENSMUST00000217653]
Predicted Effect probably damaging
Transcript: ENSMUST00000071658
AA Change: Y90C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071583
Gene: ENSMUSG00000063120
AA Change: Y90C

DomainStartEndE-ValueType
Pfam:7tm_4 61 338 1.7e-50 PFAM
Pfam:7tm_1 71 320 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084760
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081815
Gene: ENSMUSG00000063120
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-49 PFAM
Pfam:7tm_1 41 290 8.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217653
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Olfr480
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Olfr480 APN 7 108066288 missense probably benign 0.32
IGL02060:Olfr480 APN 7 108066671 missense probably benign 0.03
IGL02392:Olfr480 APN 7 108066503 missense probably benign 0.10
IGL02493:Olfr480 APN 7 108065805 missense possibly damaging 0.79
IGL02634:Olfr480 APN 7 108066771 missense probably benign 0.00
F5770:Olfr480 UTSW 7 108066678 missense probably benign 0.11
R0446:Olfr480 UTSW 7 108066725 nonsense probably null
R1070:Olfr480 UTSW 7 108066651 missense probably benign 0.00
R1862:Olfr480 UTSW 7 108066725 nonsense probably null
R1863:Olfr480 UTSW 7 108066725 nonsense probably null
R1885:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1886:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R1887:Olfr480 UTSW 7 108066778 missense probably benign 0.00
R3609:Olfr480 UTSW 7 108066369 missense probably damaging 1.00
R3921:Olfr480 UTSW 7 108065901 missense possibly damaging 0.94
R4259:Olfr480 UTSW 7 108065893 nonsense probably null
R5276:Olfr480 UTSW 7 108066216 nonsense probably null
R6224:Olfr480 UTSW 7 108066742 missense probably benign 0.00
V7581:Olfr480 UTSW 7 108066678 missense probably benign 0.11
X0021:Olfr480 UTSW 7 108066588 missense probably benign 0.01
X0066:Olfr480 UTSW 7 108066435 missense probably benign 0.00
Z1088:Olfr480 UTSW 7 108066327 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCCCAAAGAACAGAGTGACTGC -3'
(R):5'- TTTCCTGACAGAGATGGAGCCTGG -3'

Sequencing Primer
(F):5'- GCTTCAATAGTGGTGAATAGTCACAG -3'
(R):5'- ATGGAGCCTGGAAACTACAC -3'
Posted On2014-04-13