Incidental Mutation 'R1510:Myo5a'
ID167857
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75171551 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 864 (Y864H)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]
Predicted Effect probably benign
Transcript: ENSMUST00000123128
AA Change: Y864H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: Y864H

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123531
Predicted Effect probably benign
Transcript: ENSMUST00000136731
AA Change: Y864H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: Y864H

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155282
AA Change: Y864H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: Y864H

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.1492 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTACTGGCTGTCCCCATGAACTC -3'
(R):5'- TTGTAGCGTTCCACAGAGCGAG -3'

Sequencing Primer
(F):5'- CTCAGTGTAATGGGACAATCTCTG -3'
(R):5'- AGCGAGCCTCAATTTTGAGTTTC -3'
Posted On2014-04-13