Incidental Mutation 'R1510:Abcd2'
ID167885
Institutional Source Beutler Lab
Gene Symbol Abcd2
Ensembl Gene ENSMUSG00000055782
Gene NameATP-binding cassette, sub-family D (ALD), member 2
SynonymsABC39, adrenoleukodystrophy related, ALDL1, ALDR
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91145871-91191799 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91188978 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 326 (L326S)
Ref Sequence ENSEMBL: ENSMUSP00000068940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069511]
Predicted Effect probably damaging
Transcript: ENSMUST00000069511
AA Change: L326S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068940
Gene: ENSMUSG00000055782
AA Change: L326S

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Pfam:ABC_membrane_2 78 365 1.9e-110 PFAM
AAA 504 690 2.79e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230461
Meta Mutation Damage Score 0.544 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown; however this protein is speculated to function as a dimerization partner of Abcd1 and/or other peroxisomal ABC transporters. Mutations in the human gene have been observed in patients with adrenoleukodystrophy, a severe demyelinating disease. This gene has been identified as a candidate for a modifier gene, accounting for the extreme variation among adrenoleukodystrophy phenotypes. This gene is also a candidate for a complement group of Zellweger syndrome, a genetically heterogeneous disorder of peroxisomal biogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene exhibit a late-onset cerebellar and sensory ataxia, loss of Purkinje cells, dorsal root ganglia cell degeneration, axonal degeneration in the spinal cord, and an accumulation of very long chain fatty acids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Abcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Abcd2 APN 15 91149213 splice site probably benign
IGL01515:Abcd2 APN 15 91163086 missense probably damaging 1.00
IGL01733:Abcd2 APN 15 91191614 utr 5 prime probably benign
IGL02084:Abcd2 APN 15 91178327 critical splice acceptor site probably null
IGL02408:Abcd2 APN 15 91178241 missense possibly damaging 0.95
IGL02568:Abcd2 APN 15 91148981 utr 3 prime probably benign
IGL02942:Abcd2 APN 15 91149175 missense probably damaging 0.99
IGL03281:Abcd2 APN 15 91151673 missense probably damaging 1.00
R0463:Abcd2 UTSW 15 91159124 missense probably benign 0.01
R1226:Abcd2 UTSW 15 91191043 missense probably benign
R1581:Abcd2 UTSW 15 91179144 missense probably benign
R1802:Abcd2 UTSW 15 91163102 missense probably benign
R1918:Abcd2 UTSW 15 91191481 missense probably benign
R2184:Abcd2 UTSW 15 91191439 missense probably benign
R3820:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R3821:Abcd2 UTSW 15 91174705 missense probably damaging 0.99
R4486:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4487:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4489:Abcd2 UTSW 15 91178283 missense probably damaging 0.99
R4706:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4707:Abcd2 UTSW 15 91159182 missense probably benign 0.03
R4727:Abcd2 UTSW 15 91178286 missense probably benign 0.33
R4872:Abcd2 UTSW 15 91191311 missense probably benign
R4971:Abcd2 UTSW 15 91163110 missense probably benign 0.06
R5492:Abcd2 UTSW 15 91188973 missense probably benign
R6049:Abcd2 UTSW 15 91178236 missense probably benign 0.00
R6143:Abcd2 UTSW 15 91190947 missense possibly damaging 0.95
R6177:Abcd2 UTSW 15 91190693 missense probably damaging 0.99
R6566:Abcd2 UTSW 15 91191118 missense probably damaging 1.00
R7108:Abcd2 UTSW 15 91191274 missense probably benign 0.43
R7208:Abcd2 UTSW 15 91190682 nonsense probably null
R7212:Abcd2 UTSW 15 91159123 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AAGGTCCCTTGAGCTACCTGTTGC -3'
(R):5'- TAGCGTTCTGACACTGAGCTAGGC -3'

Sequencing Primer
(F):5'- GGGACATGCAATGACATCTTC -3'
(R):5'- ACTGAGCTAGGCTCCTGTC -3'
Posted On2014-04-13