Incidental Mutation 'R1506:Prex1'
ID167914
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.347) question?
Stock #R1506 (G1)
Quality Score189
Status Validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 166587081 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 694 (V694E)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
Predicted Effect probably damaging
Transcript: ENSMUST00000036719
AA Change: V864E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: V864E

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099080
AA Change: V694E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: V694E

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4685:Prex1 UTSW 2 166638332 missense probably damaging 0.97
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
X0065:Prex1 UTSW 2 166586625 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGAATCAGCAACCCCTGACCTTG -3'
(R):5'- TGGTGGCTCTGGCAACTTTGAAC -3'

Sequencing Primer
(F):5'- CTTGAGGCAGAACAGACCAG -3'
(R):5'- CAGACTGGCAGTGTCCTGATG -3'
Posted On2014-04-13