Incidental Mutation 'R1506:Oas1h'
ID167929
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120861421-120873506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120871888 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 342 (D342V)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000086368] [ENSMUST00000162096] [ENSMUST00000171820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072476
AA Change: D342V

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: D342V

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086368
SMART Domains Protein: ENSMUSP00000083555
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 1.6e-13 PFAM
Pfam:OAS1_C 164 349 6.9e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162096
SMART Domains Protein: ENSMUSP00000124597
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 42 138 1.1e-9 PFAM
Pfam:OAS1_C 163 231 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 120871834 missense probably damaging 1.00
IGL01890:Oas1h APN 5 120862789 unclassified probably null
IGL02745:Oas1h APN 5 120861479 missense probably benign 0.04
IGL02888:Oas1h APN 5 120861547 missense probably benign 0.34
IGL02970:Oas1h APN 5 120861635 missense possibly damaging 0.91
R0125:Oas1h UTSW 5 120862563 nonsense probably null
R1261:Oas1h UTSW 5 120871867 missense probably benign 0.01
R1565:Oas1h UTSW 5 120862600 missense probably damaging 0.97
R1696:Oas1h UTSW 5 120862822 critical splice donor site probably null
R1750:Oas1h UTSW 5 120871777 splice site probably null
R3116:Oas1h UTSW 5 120861616 nonsense probably null
R4814:Oas1h UTSW 5 120862665 missense probably damaging 0.99
R4906:Oas1h UTSW 5 120867109 nonsense probably null
R4944:Oas1h UTSW 5 120862783 missense probably damaging 1.00
R4961:Oas1h UTSW 5 120871096 missense probably damaging 1.00
R5160:Oas1h UTSW 5 120871082 missense probably damaging 1.00
R5698:Oas1h UTSW 5 120870982 missense probably damaging 1.00
R5903:Oas1h UTSW 5 120870977 missense probably damaging 1.00
R6014:Oas1h UTSW 5 120867166 missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120861465 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACATGTCCTGACCCCGTGTTTAATC -3'
(R):5'- GCAGTTTACAAGCAGCTTGCCTTC -3'

Sequencing Primer
(F):5'- tgccccaggacacacag -3'
(R):5'- AGCTTGCCTTCACAGAAGTG -3'
Posted On2014-04-13