Incidental Mutation 'R1506:Olfr734'
ID167953
Institutional Source Beutler Lab
Gene Symbol Olfr734
Ensembl Gene ENSMUSG00000045306
Gene Nameolfactory receptor 734
SynonymsMOR242-1, GA_x6K02T2PMLR-6013665-6012724
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.570) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50316506-50326761 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50320484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 117 (V117A)
Ref Sequence ENSEMBL: ENSMUSP00000150732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050928] [ENSMUST00000217152]
Predicted Effect probably benign
Transcript: ENSMUST00000050928
AA Change: V117A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000057376
Gene: ENSMUSG00000045306
AA Change: V117A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-39 PFAM
Pfam:7tm_1 41 302 4.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216732
Predicted Effect probably benign
Transcript: ENSMUST00000217152
AA Change: V117A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Olfr734
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr734 APN 14 50320275 missense probably damaging 0.96
IGL01285:Olfr734 APN 14 50320256 missense possibly damaging 0.88
IGL02106:Olfr734 APN 14 50320160 missense probably damaging 1.00
IGL02313:Olfr734 APN 14 50320016 missense probably damaging 0.99
IGL03125:Olfr734 APN 14 50320692 missense probably benign 0.01
R0276:Olfr734 UTSW 14 50320179 missense probably benign 0.23
R0547:Olfr734 UTSW 14 50320118 missense probably benign 0.06
R0567:Olfr734 UTSW 14 50320658 missense probably damaging 0.99
R0927:Olfr734 UTSW 14 50320729 nonsense probably null
R4032:Olfr734 UTSW 14 50320310 missense possibly damaging 0.91
R5179:Olfr734 UTSW 14 50320536 nonsense probably null
R5401:Olfr734 UTSW 14 50320109 missense probably damaging 1.00
R6240:Olfr734 UTSW 14 50320586 missense probably benign 0.00
X0064:Olfr734 UTSW 14 50320054 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGTCGAACAATGAGAGCCACCTG -3'
(R):5'- TGCAAATGATACCACCGTGACCG -3'

Sequencing Primer
(F):5'- GTATTATAGAATGTACGAAGCCCCC -3'
(R):5'- CTATCTCAGACTCGGGAAGTG -3'
Posted On2014-04-13