Incidental Mutation 'R1506:Dip2b'
ID167956
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100183113 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 879 (V879M)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: V645M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: V645M

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: V879M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: V879M

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: V645M

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: V645M

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 unclassified probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 unclassified probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 unclassified probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGGCTCCTCTTTGATTCCAAC -3'
(R):5'- GGGCAGTCACAATCTTCATGGGTAG -3'

Sequencing Primer
(F):5'- CTCTTTGATTCCAACTGAGGAAAGC -3'
(R):5'- gccttggctgtcctagaac -3'
Posted On2014-04-13