Incidental Mutation 'R1506:Muc4'
ID167957
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Namemucin 4
Synonyms4933405I11Rik
MMRRC Submission 039554-MU
Accession Numbers

Genbank: NM_080457; MGI: 2153525

Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32735886-32782391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32752233 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 704 (S704C)
Ref Sequence ENSEMBL: ENSMUSP00000093813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096106
AA Change: S704C

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: S704C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132475
SMART Domains Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 38 45 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 99 127 N/A INTRINSIC
low complexity region 148 173 N/A INTRINSIC
low complexity region 192 224 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135753
SMART Domains Protein: ENSMUSP00000119154
Gene: ENSMUSG00000079620

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 117 126 N/A INTRINSIC
low complexity region 161 180 N/A INTRINSIC
low complexity region 255 263 N/A INTRINSIC
low complexity region 275 298 N/A INTRINSIC
NIDO 389 546 8.33e-67 SMART
AMOP 545 657 1.29e-47 SMART
VWD 660 841 4.23e-26 SMART
EGF_like 1065 1097 3.23e1 SMART
EGF_like 1107 1143 3.5e1 SMART
low complexity region 1168 1182 N/A INTRINSIC
EGF 1315 1352 1.4e0 SMART
transmembrane domain 1361 1383 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142355
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00088:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00089:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00090:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00091:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00092:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00163:Muc4 APN 16 32754090 missense probably benign 0.20
IGL00324:Muc4 APN 16 32778812 missense probably benign 0.03
IGL00331:Muc4 APN 16 32753185 missense probably benign 0.01
IGL00539:Muc4 APN 16 32750910 missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32754347 missense probably benign 0.10
IGL00990:Muc4 APN 16 32753955 missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32755805 unclassified probably benign
IGL00990:Muc4 APN 16 32753823 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753848 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753849 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753863 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753886 missense probably benign 0.01
IGL00990:Muc4 APN 16 32752569 missense probably benign 0.01
IGL00990:Muc4 APN 16 32754071 missense probably benign 0.01
IGL01091:Muc4 APN 16 32753927 missense probably benign 0.04
IGL01124:Muc4 APN 16 32768730 missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32753901 missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32763966 missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32750655 missense probably benign 0.23
IGL01618:Muc4 APN 16 32756627 missense unknown
IGL01625:Muc4 APN 16 32755544 unclassified probably benign
IGL01626:Muc4 APN 16 32736402 missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32761348 splice site probably null
IGL01682:Muc4 APN 16 32754086 missense probably benign 0.35
IGL01870:Muc4 APN 16 32753196 missense probably benign 0.01
IGL01966:Muc4 APN 16 32751426 missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32754265 missense probably benign 0.01
IGL02089:Muc4 APN 16 32751313 missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32777649 splice site probably benign
IGL02210:Muc4 APN 16 32752254 missense probably benign 0.00
IGL02278:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02280:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02316:Muc4 APN 16 32750850 missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32752076 missense probably benign 0.41
IGL02449:Muc4 APN 16 32756129 unclassified probably benign
IGL02607:Muc4 APN 16 32775819 missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32755282 unclassified probably benign
IGL02893:Muc4 APN 16 32751648 missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32750394 missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32752048 missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32751948 missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32751439 nonsense probably null
IGL03335:Muc4 APN 16 32753021 missense probably benign 0.01
IGL03411:Muc4 APN 16 32754318 missense probably benign 0.01
3-1:Muc4 UTSW 16 32760251 splice site probably benign
3-1:Muc4 UTSW 16 32770394 missense possibly damaging 0.86
IGL02835:Muc4 UTSW 16 32763945 missense probably benign 0.32
P0035:Muc4 UTSW 16 32760248 splice site probably benign
PIT4131001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755699 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32754529 missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4366001:Muc4 UTSW 16 32754796 missense unknown
PIT4531001:Muc4 UTSW 16 32756017 missense unknown
R0119:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32771604 missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32765746 missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32755690 unclassified probably benign
R0299:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32752905 missense probably benign 0.00
R0462:Muc4 UTSW 16 32762536 missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32751069 missense probably benign 0.01
R0508:Muc4 UTSW 16 32751313 missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32756746 missense unknown
R0578:Muc4 UTSW 16 32755690 unclassified probably benign
R0617:Muc4 UTSW 16 32752107 missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32751670 missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32769827 missense probably damaging 0.99
R0727:Muc4 UTSW 16 32769847 missense probably benign 0.01
R0776:Muc4 UTSW 16 32752220 missense probably benign 0.04
R0854:Muc4 UTSW 16 32778955 missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0864:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0926:Muc4 UTSW 16 32756196 unclassified probably benign
R0990:Muc4 UTSW 16 32752722 missense probably benign 0.00
R1127:Muc4 UTSW 16 32750525 missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32754529 missense probably benign 0.01
R1433:Muc4 UTSW 16 32753020 missense probably benign 0.00
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1518:Muc4 UTSW 16 32750349 missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1584:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1593:Muc4 UTSW 16 32754686 missense probably benign 0.00
R1601:Muc4 UTSW 16 32755501 unclassified probably benign
R1611:Muc4 UTSW 16 32750986 missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32756902 missense probably benign 0.11
R1717:Muc4 UTSW 16 32753405 missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1824:Muc4 UTSW 16 32755933 unclassified probably benign
R1839:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1846:Muc4 UTSW 16 32752369 missense probably benign 0.01
R1864:Muc4 UTSW 16 32756251 unclassified probably benign
R1868:Muc4 UTSW 16 32756341 missense unknown
R1928:Muc4 UTSW 16 32750532 missense probably damaging 0.99
R1942:Muc4 UTSW 16 32750642 missense probably damaging 0.99
R2017:Muc4 UTSW 16 32751303 missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32752254 missense probably benign 0.00
R2081:Muc4 UTSW 16 32752220 missense probably benign 0.04
R2088:Muc4 UTSW 16 32756409 missense unknown
R2121:Muc4 UTSW 16 32760238 missense unknown
R2139:Muc4 UTSW 16 32761225 missense unknown
R2158:Muc4 UTSW 16 32754563 missense probably benign 0.10
R2165:Muc4 UTSW 16 32750476 missense probably damaging 0.96
R2210:Muc4 UTSW 16 32755176 frame shift probably null
R2225:Muc4 UTSW 16 32755891 unclassified probably benign
R2225:Muc4 UTSW 16 32766942 missense possibly damaging 0.73
R2269:Muc4 UTSW 16 32754529 missense probably benign 0.01
R2679:Muc4 UTSW 16 32757472 missense unknown
R3703:Muc4 UTSW 16 32753919 missense probably benign 0.10
R3816:Muc4 UTSW 16 32754529 missense probably benign 0.01
R3909:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4014:Muc4 UTSW 16 32755273 unclassified probably benign
R4065:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4249:Muc4 UTSW 16 32755826 unclassified probably benign
R4344:Muc4 UTSW 16 32770292 missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4393:Muc4 UTSW 16 32754529 missense probably benign 0.01
R4482:Muc4 UTSW 16 32756701 missense unknown
R4523:Muc4 UTSW 16 32736336 utr 5 prime probably benign
R4527:Muc4 UTSW 16 32755843 unclassified probably benign
R4572:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4587:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4614:Muc4 UTSW 16 32757058 missense probably benign 0.03
R4635:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4661:Muc4 UTSW 16 32769277 missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32755846 unclassified probably benign
R4730:Muc4 UTSW 16 32751214 missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32775903 missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32753625 unclassified probably benign
R4818:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4821:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4825:Muc4 UTSW 16 32751747 missense probably benign 0.41
R4830:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4860:Muc4 UTSW 16 32754616 missense probably benign 0.35
R4860:Muc4 UTSW 16 32754625 missense probably benign 0.18
R4869:Muc4 UTSW 16 32754836 unclassified probably benign
R4934:Muc4 UTSW 16 32756098 unclassified probably benign
R4959:Muc4 UTSW 16 32754319 missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32754572 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754214 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754041 missense probably benign 0.01
R4999:Muc4 UTSW 16 32756296 unclassified probably benign
R5073:Muc4 UTSW 16 32754529 missense probably benign 0.01
R5075:Muc4 UTSW 16 32754794 unclassified probably benign
R5152:Muc4 UTSW 16 32757058 nonsense probably null
R5161:Muc4 UTSW 16 32762521 missense probably damaging 0.98
R5174:Muc4 UTSW 16 32751738 missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32751666 missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32753919 missense probably benign 0.10
R5474:Muc4 UTSW 16 32761261 missense unknown
R5567:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32754253 missense probably benign 0.01
R5665:Muc4 UTSW 16 32750782 missense probably benign 0.33
R5667:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5671:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5693:Muc4 UTSW 16 32776807 missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32736241 nonsense probably null
R5708:Muc4 UTSW 16 32754769 unclassified probably benign
R5715:Muc4 UTSW 16 32751916 missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32774839 missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32751295 missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32751705 missense probably benign 0.41
R5933:Muc4 UTSW 16 32753052 missense probably benign 0.01
R5966:Muc4 UTSW 16 32756278 unclassified probably benign
R6062:Muc4 UTSW 16 32759308 missense unknown
R6067:Muc4 UTSW 16 32755247 unclassified probably benign
R6067:Muc4 UTSW 16 32754529 missense probably benign 0.01
R6078:Muc4 UTSW 16 32755247 unclassified probably benign
R6079:Muc4 UTSW 16 32755247 unclassified probably benign
R6112:Muc4 UTSW 16 32775783 missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32756795 missense unknown
R6144:Muc4 UTSW 16 32766924 missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32753802 missense probably benign 0.04
R6173:Muc4 UTSW 16 32736140 start gained probably benign
R6268:Muc4 UTSW 16 32768767 missense probably damaging 0.99
R6299:Muc4 UTSW 16 32752035 missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32753946 missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32754358 missense probably benign 0.19
R6361:Muc4 UTSW 16 32767351 missense probably benign 0.32
R6375:Muc4 UTSW 16 32736243 utr 5 prime probably benign
R6378:Muc4 UTSW 16 32778946 missense probably benign 0.33
R6418:Muc4 UTSW 16 32751789 missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32759320 critical splice donor site probably null
R6527:Muc4 UTSW 16 32753433 missense probably benign 0.01
R6616:Muc4 UTSW 16 32782008 missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6637:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6915:Muc4 UTSW 16 32766938 missense probably benign 0.18
R6947:Muc4 UTSW 16 32775803 missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32762518 missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32751999 missense probably benign 0.00
R7020:Muc4 UTSW 16 32751810 nonsense probably null
R7033:Muc4 UTSW 16 32756324 unclassified probably benign
R7098:Muc4 UTSW 16 32757091 missense
R7123:Muc4 UTSW 16 32750691 missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32762488 missense probably damaging 0.97
R7178:Muc4 UTSW 16 32752788 missense unknown
R7294:Muc4 UTSW 16 32756461 missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32755336 missense unknown
R7361:Muc4 UTSW 16 32754670 missense probably benign 0.18
R7380:Muc4 UTSW 16 32755366 missense unknown
R7381:Muc4 UTSW 16 32780915 missense
R7411:Muc4 UTSW 16 32751322 missense probably benign 0.12
R7422:Muc4 UTSW 16 32754689 missense probably benign 0.00
R7482:Muc4 UTSW 16 32766950 missense
R7539:Muc4 UTSW 16 32756396 missense
R7544:Muc4 UTSW 16 32736198 start codon destroyed probably null
U15987:Muc4 UTSW 16 32754529 missense probably benign 0.01
U15987:Muc4 UTSW 16 32755247 unclassified probably benign
V5622:Muc4 UTSW 16 32751825 missense probably benign 0.00
X0018:Muc4 UTSW 16 32755481 unclassified probably benign
X0028:Muc4 UTSW 16 32759319 critical splice donor site probably null
Z1088:Muc4 UTSW 16 32756076 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCAACCCTTTCTCAGAGCCAAC -3'
(R):5'- AGCTGAGCTGCTCATGATGGAAGC -3'

Sequencing Primer
(F):5'- TATGCTCCCATCATGAGCAG -3'
(R):5'- TGCTCATGATGGAAGCATATGAGG -3'
Posted On2014-04-13