Incidental Mutation 'R1507:Bcas1'
ID167977
Institutional Source Beutler Lab
Gene Symbol Bcas1
Ensembl Gene ENSMUSG00000013523
Gene Namebreast carcinoma amplified sequence 1
Synonyms9030223A09Rik, 2210416M21Rik, NABC1
MMRRC Submission 039555-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1507 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location170346991-170427845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 170366428 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 472 (D472G)
Ref Sequence ENSEMBL: ENSMUSP00000013667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013667] [ENSMUST00000068137] [ENSMUST00000109152]
Predicted Effect probably damaging
Transcript: ENSMUST00000013667
AA Change: D472G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000013667
Gene: ENSMUSG00000013523
AA Change: D472G

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 391 398 N/A INTRINSIC
low complexity region 542 554 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068137
AA Change: D416G

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069437
Gene: ENSMUSG00000013523
AA Change: D416G

DomainStartEndE-ValueType
low complexity region 164 177 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 335 342 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109152
AA Change: D426G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104780
Gene: ENSMUSG00000013523
AA Change: D426G

DomainStartEndE-ValueType
low complexity region 174 187 N/A INTRINSIC
low complexity region 299 312 N/A INTRINSIC
low complexity region 345 352 N/A INTRINSIC
low complexity region 496 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131931
Predicted Effect probably benign
Transcript: ENSMUST00000154650
SMART Domains Protein: ENSMUSP00000122298
Gene: ENSMUSG00000013523

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene resides in a region at 20q13 which is amplified in a variety of tumor types and associated with more aggressive tumor phenotypes. Among the genes identified from this region, it was found to be highly expressed in three amplified breast cancer cell lines and in one breast tumor without amplification at 20q13.2. However, this gene is not in the common region of maximal amplification and its expression was not detected in the breast cancer cell line MCF7, in which this region is highly amplified. Although not consistently expressed, this gene is a candidate oncogene. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik T G 2: 154,549,619 V102G probably benign Het
4931423N10Rik A G 2: 23,208,074 Y88C probably damaging Het
Adgrv1 T C 13: 81,472,580 probably null Het
Ahnak T A 19: 9,010,077 D2908E probably damaging Het
Aox1 A G 1: 58,104,451 M1243V probably benign Het
Apobec2 T C 17: 48,422,975 D221G possibly damaging Het
Btnl7-ps T A 17: 34,541,463 noncoding transcript Het
Cd209d G T 8: 3,878,453 Q11K possibly damaging Het
Cdc14a G A 3: 116,293,997 T455I possibly damaging Het
Cep120 A G 18: 53,697,657 S843P probably damaging Het
Cped1 A T 6: 22,122,261 H380L probably damaging Het
D430042O09Rik T A 7: 125,866,352 D1325E probably damaging Het
Derl2 A T 11: 71,007,345 W233R probably benign Het
Drd5 A T 5: 38,320,722 I353F probably damaging Het
E330034G19Rik A T 14: 24,306,987 Q197L possibly damaging Het
Edil3 T A 13: 89,131,712 S170T probably damaging Het
Gldc T A 19: 30,118,638 T658S probably damaging Het
Gpr146 A G 5: 139,393,369 M309V probably benign Het
Hexim2 T A 11: 103,138,321 C66* probably null Het
Hist2h2bb A G 3: 96,269,873 Y41C probably damaging Het
Htr2a T C 14: 74,705,979 V333A probably damaging Het
Igdcc4 A G 9: 65,133,744 E1065G probably damaging Het
Kcnk9 T A 15: 72,512,234 E365V possibly damaging Het
Kif28 T A 1: 179,736,006 N135I probably damaging Het
Kmt2a A T 9: 44,818,403 probably benign Het
Lamb2 A T 9: 108,490,382 I1788F probably damaging Het
Lsm6 G A 8: 78,812,979 R31* probably null Het
Mical3 T A 6: 121,042,238 T8S probably benign Het
Ncapg2 T C 12: 116,460,566 F1123S probably benign Het
Nprl2 A G 9: 107,542,992 D30G probably benign Het
Olfr206 A T 16: 59,345,493 D69E probably damaging Het
Olfr630 C T 7: 103,755,021 R188H probably benign Het
Olfr916 A T 9: 38,658,014 I126N probably damaging Het
Parvg T A 15: 84,330,158 V181E probably damaging Het
Pfas T C 11: 68,990,034 T1106A probably benign Het
Plekhh1 A T 12: 79,079,450 T1310S probably damaging Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef2 A T 3: 79,081,293 probably benign Het
Rfx3 G T 19: 27,768,513 T731K probably benign Het
Rnf31 A T 14: 55,598,982 K634* probably null Het
Scp2 CACTTTAATAATACTTT CACTTT 4: 108,087,012 probably null Het
Set A G 2: 30,069,094 H101R probably damaging Het
Slc30a6 G T 17: 74,408,862 V106F probably damaging Het
Slc47a1 A T 11: 61,359,518 probably null Het
Spaca3 G A 11: 80,863,157 R40H probably damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Tenm3 A G 8: 48,287,822 S1209P probably benign Het
Tmprss11g T C 5: 86,499,611 T23A probably benign Het
Topors A G 4: 40,261,829 V485A probably damaging Het
Tpgs1 T A 10: 79,675,786 L254Q probably damaging Het
Traf3 A C 12: 111,260,760 T336P probably benign Het
Ttn T A 2: 76,880,590 probably benign Het
Ubr5 G A 15: 37,980,870 R2388W probably damaging Het
Unc13a A G 8: 71,658,266 S434P probably benign Het
Usp33 A G 3: 152,374,763 I510M possibly damaging Het
Vmn1r65 C A 7: 6,009,109 G42V probably benign Het
Xab2 A G 8: 3,616,031 L262S possibly damaging Het
Yap1 A T 9: 7,953,140 probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfp609 A G 9: 65,794,777 Y198H possibly damaging Het
Zfp629 T A 7: 127,611,861 K259* probably null Het
Other mutations in Bcas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01647:Bcas1 APN 2 170349252 missense probably damaging 0.99
IGL01714:Bcas1 APN 2 170384182 splice site probably benign
IGL02267:Bcas1 APN 2 170378788 nonsense probably null
IGL02486:Bcas1 APN 2 170406398 missense probably damaging 1.00
IGL03328:Bcas1 APN 2 170366396 nonsense probably null
R0335:Bcas1 UTSW 2 170418681 missense probably damaging 0.97
R1458:Bcas1 UTSW 2 170387951 missense probably damaging 1.00
R1463:Bcas1 UTSW 2 170418664 missense probably benign 0.07
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1467:Bcas1 UTSW 2 170387932 missense possibly damaging 0.92
R1645:Bcas1 UTSW 2 170387167 missense probably damaging 1.00
R1654:Bcas1 UTSW 2 170349246 missense probably damaging 1.00
R1911:Bcas1 UTSW 2 170387943 missense probably damaging 1.00
R1990:Bcas1 UTSW 2 170370477 missense possibly damaging 0.83
R2017:Bcas1 UTSW 2 170348161 splice site probably null
R4119:Bcas1 UTSW 2 170378815 missense probably benign 0.02
R4181:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4302:Bcas1 UTSW 2 170418627 missense probably benign 0.26
R4497:Bcas1 UTSW 2 170406821 missense probably damaging 1.00
R4670:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4671:Bcas1 UTSW 2 170384325 missense probably damaging 0.99
R4914:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4915:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4917:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R4918:Bcas1 UTSW 2 170378886 missense probably damaging 1.00
R5155:Bcas1 UTSW 2 170418618 missense probably damaging 0.98
R5354:Bcas1 UTSW 2 170349396 missense possibly damaging 0.94
R5686:Bcas1 UTSW 2 170406810 missense probably benign 0.03
R7566:Bcas1 UTSW 2 170370449 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATGCCTCATCACAGTGAAGGCTC -3'
(R):5'- TCTGTCTGTCTGGTGTTCAGCAATC -3'

Sequencing Primer
(F):5'- TGAAGGCTCACACATGGAC -3'
(R):5'- gtctgGTGTTCAGCAATCATATGTC -3'
Posted On2014-04-13