Incidental Mutation 'R1507:Xab2'
ID167995
Institutional Source Beutler Lab
Gene Symbol Xab2
Ensembl Gene ENSMUSG00000019470
Gene NameXPA binding protein 2
Synonyms0610041O14Rik
MMRRC Submission 039555-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1507 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3608421-3621316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3616031 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 262 (L262S)
Ref Sequence ENSEMBL: ENSMUSP00000019614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019614] [ENSMUST00000159235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019614
AA Change: L262S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470
AA Change: L262S

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122654
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159548
AA Change: L248S

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470
AA Change: L248S

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Homozygous null embryos die by the blastocyst stage (E3.5) and some eight-cell stage embryos do not undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik T G 2: 154,549,619 V102G probably benign Het
4931423N10Rik A G 2: 23,208,074 Y88C probably damaging Het
Adgrv1 T C 13: 81,472,580 probably null Het
Ahnak T A 19: 9,010,077 D2908E probably damaging Het
Aox1 A G 1: 58,104,451 M1243V probably benign Het
Apobec2 T C 17: 48,422,975 D221G possibly damaging Het
Bcas1 T C 2: 170,366,428 D472G probably damaging Het
Btnl7-ps T A 17: 34,541,463 noncoding transcript Het
Cd209d G T 8: 3,878,453 Q11K possibly damaging Het
Cdc14a G A 3: 116,293,997 T455I possibly damaging Het
Cep120 A G 18: 53,697,657 S843P probably damaging Het
Cped1 A T 6: 22,122,261 H380L probably damaging Het
D430042O09Rik T A 7: 125,866,352 D1325E probably damaging Het
Derl2 A T 11: 71,007,345 W233R probably benign Het
Drd5 A T 5: 38,320,722 I353F probably damaging Het
E330034G19Rik A T 14: 24,306,987 Q197L possibly damaging Het
Edil3 T A 13: 89,131,712 S170T probably damaging Het
Gldc T A 19: 30,118,638 T658S probably damaging Het
Gpr146 A G 5: 139,393,369 M309V probably benign Het
Hexim2 T A 11: 103,138,321 C66* probably null Het
Hist2h2bb A G 3: 96,269,873 Y41C probably damaging Het
Htr2a T C 14: 74,705,979 V333A probably damaging Het
Igdcc4 A G 9: 65,133,744 E1065G probably damaging Het
Kcnk9 T A 15: 72,512,234 E365V possibly damaging Het
Kif28 T A 1: 179,736,006 N135I probably damaging Het
Kmt2a A T 9: 44,818,403 probably benign Het
Lamb2 A T 9: 108,490,382 I1788F probably damaging Het
Lsm6 G A 8: 78,812,979 R31* probably null Het
Mical3 T A 6: 121,042,238 T8S probably benign Het
Ncapg2 T C 12: 116,460,566 F1123S probably benign Het
Nprl2 A G 9: 107,542,992 D30G probably benign Het
Olfr206 A T 16: 59,345,493 D69E probably damaging Het
Olfr630 C T 7: 103,755,021 R188H probably benign Het
Olfr916 A T 9: 38,658,014 I126N probably damaging Het
Parvg T A 15: 84,330,158 V181E probably damaging Het
Pfas T C 11: 68,990,034 T1106A probably benign Het
Plekhh1 A T 12: 79,079,450 T1310S probably damaging Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef2 A T 3: 79,081,293 probably benign Het
Rfx3 G T 19: 27,768,513 T731K probably benign Het
Rnf31 A T 14: 55,598,982 K634* probably null Het
Scp2 CACTTTAATAATACTTT CACTTT 4: 108,087,012 probably null Het
Set A G 2: 30,069,094 H101R probably damaging Het
Slc30a6 G T 17: 74,408,862 V106F probably damaging Het
Slc47a1 A T 11: 61,359,518 probably null Het
Spaca3 G A 11: 80,863,157 R40H probably damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Tenm3 A G 8: 48,287,822 S1209P probably benign Het
Tmprss11g T C 5: 86,499,611 T23A probably benign Het
Topors A G 4: 40,261,829 V485A probably damaging Het
Tpgs1 T A 10: 79,675,786 L254Q probably damaging Het
Traf3 A C 12: 111,260,760 T336P probably benign Het
Ttn T A 2: 76,880,590 probably benign Het
Ubr5 G A 15: 37,980,870 R2388W probably damaging Het
Unc13a A G 8: 71,658,266 S434P probably benign Het
Usp33 A G 3: 152,374,763 I510M possibly damaging Het
Vmn1r65 C A 7: 6,009,109 G42V probably benign Het
Yap1 A T 9: 7,953,140 probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfp609 A G 9: 65,794,777 Y198H possibly damaging Het
Zfp629 T A 7: 127,611,861 K259* probably null Het
Other mutations in Xab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Xab2 APN 8 3611723 missense probably damaging 1.00
IGL01308:Xab2 APN 8 3616332 missense probably benign 0.07
IGL01324:Xab2 APN 8 3621232 missense possibly damaging 0.80
IGL01340:Xab2 APN 8 3614381 missense probably damaging 1.00
IGL01613:Xab2 APN 8 3610880 missense probably benign 0.01
IGL02622:Xab2 APN 8 3611699 missense probably benign 0.01
IGL02809:Xab2 APN 8 3610175 missense probably benign 0.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0544:Xab2 UTSW 8 3610994 missense probably damaging 1.00
R0607:Xab2 UTSW 8 3613605 missense probably benign 0.05
R0735:Xab2 UTSW 8 3613649 missense possibly damaging 0.50
R0943:Xab2 UTSW 8 3613667 missense probably benign 0.00
R1664:Xab2 UTSW 8 3619068 unclassified probably null
R1954:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R1955:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R3767:Xab2 UTSW 8 3619053 missense probably damaging 1.00
R4399:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4421:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4440:Xab2 UTSW 8 3616353 missense probably benign 0.01
R4553:Xab2 UTSW 8 3611015 missense probably benign 0.00
R4580:Xab2 UTSW 8 3610162 missense probably damaging 1.00
R4608:Xab2 UTSW 8 3618105 missense probably benign 0.23
R4707:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
R5522:Xab2 UTSW 8 3611718 missense probably benign 0.06
R6063:Xab2 UTSW 8 3613051 missense possibly damaging 0.93
R6273:Xab2 UTSW 8 3611822 missense probably damaging 1.00
R6487:Xab2 UTSW 8 3613879 missense possibly damaging 0.75
R7140:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGTCCCGAAGGTTCACCTGTCTAC -3'
(R):5'- AAATCCAGTGACCGGCTAGACGAG -3'

Sequencing Primer
(F):5'- GGTTCACCTGTCTACAGGACTC -3'
(R):5'- TGTATCCAAGGCTGGTAAATCC -3'
Posted On2014-04-13