Incidental Mutation 'R1507:Traf3'
ID168018
Institutional Source Beutler Lab
Gene Symbol Traf3
Ensembl Gene ENSMUSG00000021277
Gene NameTNF receptor-associated factor 3
SynonymsLAP1, CRAF1, CD40bp, CAP-1
MMRRC Submission 039555-MU
Accession Numbers
Stock #R1507 (G1)
Quality Score216
Status Validated
Chromosome12
Chromosomal Location111166370-111267153 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 111260760 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 336 (T336P)
Ref Sequence ENSEMBL: ENSMUSP00000021706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021706] [ENSMUST00000060274] [ENSMUST00000117269]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021706
AA Change: T361P

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021706
Gene: ENSMUSG00000021277
AA Change: T361P

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 4.6e-18 PFAM
Pfam:zf-TRAF 191 250 9.9e-14 PFAM
coiled coil region 298 337 N/A INTRINSIC
MATH 419 542 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060274
AA Change: T336P

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058361
Gene: ENSMUSG00000021277
AA Change: T336P

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117269
AA Change: T336P

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112517
Gene: ENSMUSG00000021277
AA Change: T336P

DomainStartEndE-ValueType
RING 52 87 5.85e-2 SMART
Pfam:zf-TRAF 135 191 1.5e-17 PFAM
coiled coil region 273 312 N/A INTRINSIC
MATH 394 517 5.69e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143395
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 100% (66/66)
MGI Phenotype Homozygous mutation of this gene results in progressive runting, hypoglycemia, and depletion of peripheral white blood cells, leading to death by 10 days of age. Immune responses to T-dependent antigen are impaired in lethally irradiated mice reconstituted with mutant cells.
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik T G 2: 154,549,619 V102G probably benign Het
4931423N10Rik A G 2: 23,208,074 Y88C possibly damaging Het
Adgrv1 T C 13: 81,472,580 probably null Het
Ahnak T A 19: 9,010,077 D2908E probably damaging Het
Aox1 A G 1: 58,104,451 M1243V probably benign Het
Apobec2 T C 17: 48,422,975 D221G possibly damaging Het
Bcas1 T C 2: 170,366,428 D472G probably damaging Het
Btnl7-ps T A 17: 34,541,463 noncoding transcript Het
Cd209d G T 8: 3,878,453 Q11K possibly damaging Het
Cdc14a G A 3: 116,293,997 T455I possibly damaging Het
Cep120 A G 18: 53,697,657 S843P probably damaging Het
Cped1 A T 6: 22,122,261 H380L probably damaging Het
D430042O09Rik T A 7: 125,866,352 D1325E probably damaging Het
Derl2 A T 11: 71,007,345 W233R probably benign Het
Drd5 A T 5: 38,320,722 I353F probably damaging Het
E330034G19Rik A T 14: 24,306,987 Q197L possibly damaging Het
Edil3 T A 13: 89,131,712 S170T probably damaging Het
Gldc T A 19: 30,118,638 T658S probably damaging Het
Gm1305 T A 1: 179,736,006 N95I probably damaging Het
Gpr146 A G 5: 139,393,369 M309V probably benign Het
Hexim2 T A 11: 103,138,321 C66* probably null Het
Hist2h2bb A G 3: 96,269,873 Y41C probably damaging Het
Htr2a T C 14: 74,705,979 V333A probably damaging Het
Igdcc4 A G 9: 65,133,744 E1065G probably damaging Het
Kcnk9 T A 15: 72,512,234 E365V possibly damaging Het
Kmt2a A T 9: 44,818,403 I3539N unknown Het
Lamb2 A T 9: 108,490,382 I1788F probably damaging Het
Lsm6 G A 8: 78,812,979 R31* probably null Het
Mical3 T A 6: 121,042,238 T8S probably benign Het
Ncapg2 T C 12: 116,460,566 F1123S probably benign Het
Nprl2 A G 9: 107,542,992 D30G probably benign Het
Olfr206 A T 16: 59,345,493 D69E probably damaging Het
Olfr630 C T 7: 103,755,021 R188H probably benign Het
Olfr916 A T 9: 38,658,014 I126N probably damaging Het
Parvg T A 15: 84,330,158 V181E probably damaging Het
Pfas T C 11: 68,990,034 T1106A probably benign Het
Plekhh1 A T 12: 79,079,450 T1310S probably damaging Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef2 A T 3: 79,081,293 unknown Het
Rfx3 G T 19: 27,768,513 T731K probably benign Het
Rnf31 A T 14: 55,598,982 K789* probably null Het
Scp2 CACTTTAATAATACTTT CACTTT 4: 108,087,012 probably null Het
Set A G 2: 30,069,094 H101R probably damaging Het
Slc30a6 G T 17: 74,408,862 V106F probably damaging Het
Slc47a1 A T 11: 61,359,518 noncoding transcript Het
Spaca3 G A 11: 80,863,157 R40H probably damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Tenm3 A G 8: 48,287,822 S1209P probably benign Het
Tmprss11g T C 5: 86,499,611 T23A probably benign Het
Topors A G 4: 40,261,829 V485A probably damaging Het
Tpgs1 T A 10: 79,675,786 L254Q probably damaging Het
Ttn T A 2: 76,880,590 Q8400L unknown Het
Ubr5 G A 15: 37,980,870 R2394W probably damaging Het
Unc13a A G 8: 71,658,266 S434P probably benign Het
Usp33 A G 3: 152,374,763 I510M possibly damaging Het
Vmn1r65 C A 7: 6,009,109 G42V probably benign Het
Xab2 A G 8: 3,616,031 L262S possibly damaging Het
Yap1 A T 9: 7,953,140 probably null Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfp609 A G 9: 65,794,777 Y198H possibly damaging Het
Zfp629 T A 7: 127,611,861 K259* probably null Het
Other mutations in Traf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Traf3 APN 12 111239067 missense probably damaging 0.99
IGL02015:Traf3 APN 12 111252740 missense probably benign
IGL02318:Traf3 APN 12 111237597 missense probably benign
IGL02429:Traf3 APN 12 111243465 missense probably benign 0.19
IGL03088:Traf3 APN 12 111261843 missense probably damaging 0.99
bananasplit UTSW 12 111262036 missense probably damaging 1.00
han UTSW 12 111261576 missense
Hulk UTSW 12 111261576 missense probably damaging 1.00
JAX1:Traf3 UTSW 12 111260661 missense probably benign 0.21
JAX1:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R0023:Traf3 UTSW 12 111243478 nonsense probably null
R0143:Traf3 UTSW 12 111261576 missense probably damaging 1.00
R1453:Traf3 UTSW 12 111255323 missense probably damaging 0.96
R1651:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R1714:Traf3 UTSW 12 111242473 missense probably benign 0.01
R1996:Traf3 UTSW 12 111260661 missense probably benign 0.21
R1997:Traf3 UTSW 12 111260661 missense probably benign 0.21
R3946:Traf3 UTSW 12 111255245 missense possibly damaging 0.91
R4477:Traf3 UTSW 12 111248602 missense probably benign 0.00
R4621:Traf3 UTSW 12 111260786 synonymous silent
R4645:Traf3 UTSW 12 111261966 missense probably damaging 1.00
R4723:Traf3 UTSW 12 111262036 missense probably damaging 1.00
R4820:Traf3 UTSW 12 111260770 missense possibly damaging 0.96
R5123:Traf3 UTSW 12 111243518 missense possibly damaging 0.52
R5775:Traf3 UTSW 12 111252728 missense possibly damaging 0.91
R5825:Traf3 UTSW 12 111255361 nonsense probably null
R5912:Traf3 UTSW 12 111255349 missense probably benign 0.01
X0052:Traf3 UTSW 12 111252736 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCCAGCTTGCATTTGGGGTGAC -3'
(R):5'- GCAATGCCAGAAATACTTGGGCAAC -3'

Sequencing Primer
(F):5'- GCATTTGGGGTGACAGCAC -3'
(R):5'- TACTTGGGCAACACTAGGCTG -3'
Posted OnApr 13, 2014