Incidental Mutation 'R1508:Col4a4'
ID168040
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Namecollagen, type IV, alpha 4
SynonymsE130010M05Rik, [a]4(IV)
MMRRC Submission 040869-MU
Accession Numbers

Genbank: NM_007735; MGI: 104687

Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R1508 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location82448423-82586849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82455836 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1462 (L1462H)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: L1462H
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: L1462H

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,581,921 E401G probably benign Het
Agbl4 T C 4: 111,656,398 I447T probably benign Het
Alpk2 C A 18: 65,349,305 G544V probably damaging Het
Apob T C 12: 8,011,481 I3321T possibly damaging Het
Ccdc47 C T 11: 106,202,416 D70N probably damaging Het
Ceacam13 T A 7: 18,011,071 V22D possibly damaging Het
Cep76 A G 18: 67,623,288 M491T probably damaging Het
Clec4a3 A T 6: 122,967,508 N171I probably benign Het
Col20a1 A G 2: 180,992,577 I112V probably damaging Het
Cubn A G 2: 13,427,105 F1226L probably benign Het
Cyp4a31 T A 4: 115,565,053 I77K possibly damaging Het
Dcaf1 A T 9: 106,854,177 T618S probably damaging Het
Echdc3 A T 2: 6,206,420 S129T probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat1 T C 8: 45,026,862 F2982L probably benign Het
Gm11639 T C 11: 104,710,677 V272A probably benign Het
Gm9476 A T 10: 100,306,838 noncoding transcript Het
Golga1 A G 2: 39,023,249 M542T probably benign Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
Jazf1 G A 6: 52,812,181 H103Y probably damaging Het
Klhl12 T C 1: 134,488,974 V478A possibly damaging Het
Lpcat2b A T 5: 107,433,464 T220S probably damaging Het
Myocd C T 11: 65,184,516 C594Y probably damaging Het
Nf1 A G 11: 79,440,909 E700G probably damaging Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr625-ps1 T C 7: 103,683,471 V251A possibly damaging Het
Papln A G 12: 83,782,916 Q937R probably damaging Het
Pex14 T C 4: 148,967,572 R147G probably damaging Het
Plppr3 A T 10: 79,867,540 Y37N probably damaging Het
Polr1b A G 2: 129,113,734 T522A probably benign Het
Ppp3cb T C 14: 20,524,424 N201S probably damaging Het
Prf1 A G 10: 61,303,550 D429G probably damaging Het
Ptprn2 T C 12: 117,184,722 S701P probably damaging Het
Rp1l1 C T 14: 64,030,892 T1309I possibly damaging Het
Sipa1l1 T A 12: 82,440,893 M1647K probably damaging Het
Skint11 T C 4: 114,231,766 probably null Het
Slc8a2 T C 7: 16,140,597 Y257H probably benign Het
Slfn1 T A 11: 83,121,355 I99N probably damaging Het
Slit2 A G 5: 48,192,249 T282A probably damaging Het
Slit3 A T 11: 35,570,621 D228V probably damaging Het
Specc1l A G 10: 75,307,238 N1031S probably benign Het
Supt6 A G 11: 78,216,203 probably null Het
Tdrd1 G A 19: 56,851,358 E617K probably damaging Het
Tex15 C G 8: 33,576,852 F2103L probably damaging Het
Trim21 T A 7: 102,559,576 Q312L possibly damaging Het
Trim56 C T 5: 137,113,937 A242T probably benign Het
Usp4 T C 9: 108,372,674 V467A probably benign Het
Vmn2r65 T A 7: 84,940,678 I677L probably benign Het
Vstm4 T C 14: 32,863,554 V26A probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfat T A 15: 68,178,751 K807I probably damaging Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82491641 missense unknown
IGL01092:Col4a4 APN 1 82466545 missense unknown
IGL01104:Col4a4 APN 1 82466545 missense unknown
IGL01413:Col4a4 APN 1 82471248 missense unknown
IGL01518:Col4a4 APN 1 82455759 missense unknown
IGL02014:Col4a4 APN 1 82523960 splice site probably benign
IGL02215:Col4a4 APN 1 82453809 missense unknown
IGL02707:Col4a4 APN 1 82493516 missense unknown
IGL02858:Col4a4 APN 1 82528483 missense unknown
IGL02987:Col4a4 APN 1 82498925 splice site probably benign
IGL03384:Col4a4 APN 1 82484438 missense probably benign 0.04
aoba UTSW 1 82535740 critical splice donor site probably benign
IGL02980:Col4a4 UTSW 1 82469477 critical splice donor site probably null
R0028:Col4a4 UTSW 1 82487510 critical splice donor site probably null
R0083:Col4a4 UTSW 1 82507111 critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82492549 missense unknown
R0788:Col4a4 UTSW 1 82524996 missense unknown
R0789:Col4a4 UTSW 1 82524996 missense unknown
R0790:Col4a4 UTSW 1 82524996 missense unknown
R0894:Col4a4 UTSW 1 82529656 splice site probably null
R1217:Col4a4 UTSW 1 82489009 critical splice donor site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1465:Col4a4 UTSW 1 82497822 splice site probably null
R1474:Col4a4 UTSW 1 82480486 nonsense probably null
R1640:Col4a4 UTSW 1 82535770 missense unknown
R1678:Col4a4 UTSW 1 82486659 missense unknown
R1827:Col4a4 UTSW 1 82539988 missense unknown
R1930:Col4a4 UTSW 1 82466600 splice site probably null
R1931:Col4a4 UTSW 1 82466600 splice site probably null
R2092:Col4a4 UTSW 1 82498946 missense unknown
R2122:Col4a4 UTSW 1 82456871 missense unknown
R2132:Col4a4 UTSW 1 82497860 missense unknown
R2396:Col4a4 UTSW 1 82507072 missense unknown
R2418:Col4a4 UTSW 1 82532936 missense unknown
R2679:Col4a4 UTSW 1 82529611 missense unknown
R3085:Col4a4 UTSW 1 82529564 critical splice donor site probably null
R3437:Col4a4 UTSW 1 82497168 missense unknown
R3697:Col4a4 UTSW 1 82541237 missense unknown
R3730:Col4a4 UTSW 1 82455751 synonymous probably null
R3752:Col4a4 UTSW 1 82480494 missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82471188 critical splice donor site probably null
R4087:Col4a4 UTSW 1 82523922 missense unknown
R4088:Col4a4 UTSW 1 82523922 missense unknown
R4090:Col4a4 UTSW 1 82523922 missense unknown
R4213:Col4a4 UTSW 1 82453144 missense unknown
R4422:Col4a4 UTSW 1 82489838 missense unknown
R4596:Col4a4 UTSW 1 82471219 missense unknown
R4755:Col4a4 UTSW 1 82541174 missense unknown
R4757:Col4a4 UTSW 1 82528466 missense unknown
R4793:Col4a4 UTSW 1 82539099 missense unknown
R4812:Col4a4 UTSW 1 82462153 missense unknown
R4833:Col4a4 UTSW 1 82529602 missense unknown
R5259:Col4a4 UTSW 1 82453893 missense unknown
R5264:Col4a4 UTSW 1 82493591 missense unknown
R5265:Col4a4 UTSW 1 82493591 missense unknown
R5281:Col4a4 UTSW 1 82493591 missense unknown
R5283:Col4a4 UTSW 1 82493591 missense unknown
R5284:Col4a4 UTSW 1 82493591 missense unknown
R5387:Col4a4 UTSW 1 82493591 missense unknown
R5388:Col4a4 UTSW 1 82493591 missense unknown
R5435:Col4a4 UTSW 1 82454007 missense unknown
R5534:Col4a4 UTSW 1 82487517 missense unknown
R5666:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5670:Col4a4 UTSW 1 82485579 critical splice donor site probably null
R5943:Col4a4 UTSW 1 82525016 missense unknown
R5996:Col4a4 UTSW 1 82455728 missense unknown
R5999:Col4a4 UTSW 1 82492619 missense unknown
R6112:Col4a4 UTSW 1 82453883 missense unknown
R6192:Col4a4 UTSW 1 82484430 missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82507031 missense unknown
R6419:Col4a4 UTSW 1 82466486 critical splice donor site probably null
R6458:Col4a4 UTSW 1 82455825 missense unknown
R6460:Col4a4 UTSW 1 82466532 missense unknown
R6481:Col4a4 UTSW 1 82453778 missense unknown
R6522:Col4a4 UTSW 1 82487583 missense unknown
X0020:Col4a4 UTSW 1 82539952 critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82453196 missense unknown
Predicted Primers PCR Primer
(F):5'- TGAATGACCCCTTACAGCACATGAC -3'
(R):5'- TCAGCCTTGCAGAAGCACAGAG -3'

Sequencing Primer
(F):5'- CAGCACATGACAGCTTATTCTTG -3'
(R):5'- AGCACAGAGGCTTTGCTG -3'
Posted On2014-04-13