Incidental Mutation 'R1508:Golga1'
ID168045
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission 040869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R1508 (G1)
Quality Score108
Status Not validated
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39023249 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 542 (M542T)
Ref Sequence ENSEMBL: ENSMUSP00000139001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000184996]
Predicted Effect probably benign
Transcript: ENSMUST00000039165
AA Change: M542T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: M542T

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083193
Predicted Effect probably benign
Transcript: ENSMUST00000112850
AA Change: M517T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: M517T

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126520
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149842
Predicted Effect probably benign
Transcript: ENSMUST00000153914
Predicted Effect probably benign
Transcript: ENSMUST00000154210
Predicted Effect probably benign
Transcript: ENSMUST00000184996
AA Change: M542T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: M542T

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204127
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,581,921 E401G probably benign Het
Agbl4 T C 4: 111,656,398 I447T probably benign Het
Alpk2 C A 18: 65,349,305 G544V probably damaging Het
Apob T C 12: 8,011,481 I3321T possibly damaging Het
Ccdc47 C T 11: 106,202,416 D70N probably damaging Het
Ceacam13 T A 7: 18,011,071 V22D possibly damaging Het
Cep76 A G 18: 67,623,288 M491T probably damaging Het
Clec4a3 A T 6: 122,967,508 N171I probably benign Het
Col20a1 A G 2: 180,992,577 I112V probably damaging Het
Col4a4 A T 1: 82,455,836 L1462H unknown Het
Cubn A G 2: 13,427,105 F1226L probably benign Het
Cyp4a31 T A 4: 115,565,053 I77K possibly damaging Het
Dcaf1 A T 9: 106,854,177 T618S probably damaging Het
Echdc3 A T 2: 6,206,420 S129T probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat1 T C 8: 45,026,862 F2982L probably benign Het
Gm11639 T C 11: 104,710,677 V272A probably benign Het
Gm9476 A T 10: 100,306,838 noncoding transcript Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
Jazf1 G A 6: 52,812,181 H103Y probably damaging Het
Klhl12 T C 1: 134,488,974 V478A possibly damaging Het
Lpcat2b A T 5: 107,433,464 T220S probably damaging Het
Myocd C T 11: 65,184,516 C594Y probably damaging Het
Nf1 A G 11: 79,440,909 E700G probably damaging Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr625-ps1 T C 7: 103,683,471 V251A possibly damaging Het
Papln A G 12: 83,782,916 Q937R probably damaging Het
Pex14 T C 4: 148,967,572 R147G probably damaging Het
Plppr3 A T 10: 79,867,540 Y37N probably damaging Het
Polr1b A G 2: 129,113,734 T522A probably benign Het
Ppp3cb T C 14: 20,524,424 N201S probably damaging Het
Prf1 A G 10: 61,303,550 D429G probably damaging Het
Ptprn2 T C 12: 117,184,722 S701P probably damaging Het
Rp1l1 C T 14: 64,030,892 T1309I possibly damaging Het
Sipa1l1 T A 12: 82,440,893 M1647K probably damaging Het
Skint11 T C 4: 114,231,766 probably null Het
Slc8a2 T C 7: 16,140,597 Y257H probably benign Het
Slfn1 T A 11: 83,121,355 I99N probably damaging Het
Slit2 A G 5: 48,192,249 T282A probably damaging Het
Slit3 A T 11: 35,570,621 D228V probably damaging Het
Specc1l A G 10: 75,307,238 N1031S probably benign Het
Supt6 A G 11: 78,216,203 probably null Het
Tdrd1 G A 19: 56,851,358 E617K probably damaging Het
Tex15 C G 8: 33,576,852 F2103L probably damaging Het
Trim21 T A 7: 102,559,576 Q312L possibly damaging Het
Trim56 C T 5: 137,113,937 A242T probably benign Het
Usp4 T C 9: 108,372,674 V467A probably benign Het
Vmn2r65 T A 7: 84,940,678 I677L probably benign Het
Vstm4 T C 14: 32,863,554 V26A probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfat T A 15: 68,178,751 K807I probably damaging Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0167:Golga1 UTSW 2 39047648 missense probably benign 0.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0443:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0906:Golga1 UTSW 2 39047643 missense probably damaging 0.99
R1901:Golga1 UTSW 2 39047780 splice site probably null
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 unclassified probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
R7067:Golga1 UTSW 2 39047719 missense probably benign 0.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGGTGCTGCACACAGATGG -3'
(R):5'- TCCAGAAGGAGCAGGAACTTCGAC -3'

Sequencing Primer
(F):5'- GGCCCTAACAGTGCAGAG -3'
(R):5'- GCAGTCACTAGCTCACACTA -3'
Posted On2014-04-13