Incidental Mutation 'R1508:Vmn2r65'
ID168064
Institutional Source Beutler Lab
Gene Symbol Vmn2r65
Ensembl Gene ENSMUSG00000066372
Gene Namevomeronasal 2, receptor 65
SynonymsENSMUSG00000070600
MMRRC Submission 040869-MU
Accession Numbers

Genbank: NM_001105180; MGI: 3642776

Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1508 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84940169-84964009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84940678 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 677 (I677L)
Ref Sequence ENSEMBL: ENSMUSP00000036551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044583]
Predicted Effect probably benign
Transcript: ENSMUST00000044583
AA Change: I677L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036551
Gene: ENSMUSG00000066372
AA Change: I677L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 435 5.6e-41 PFAM
Pfam:NCD3G 501 553 1.3e-21 PFAM
Pfam:7tm_3 584 821 2.3e-53 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,581,921 E401G probably benign Het
Agbl4 T C 4: 111,656,398 I447T probably benign Het
Alpk2 C A 18: 65,349,305 G544V probably damaging Het
Apob T C 12: 8,011,481 I3321T possibly damaging Het
Ccdc47 C T 11: 106,202,416 D70N probably damaging Het
Ceacam13 T A 7: 18,011,071 V22D possibly damaging Het
Cep76 A G 18: 67,623,288 M491T probably damaging Het
Clec4a3 A T 6: 122,967,508 N171I probably benign Het
Col20a1 A G 2: 180,992,577 I112V probably damaging Het
Col4a4 A T 1: 82,455,836 L1462H unknown Het
Cubn A G 2: 13,427,105 F1226L probably benign Het
Cyp4a31 T A 4: 115,565,053 I77K possibly damaging Het
Dcaf1 A T 9: 106,854,177 T618S probably damaging Het
Echdc3 A T 2: 6,206,420 S129T probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat1 T C 8: 45,026,862 F2982L probably benign Het
Gm11639 T C 11: 104,710,677 V272A probably benign Het
Gm9476 A T 10: 100,306,838 noncoding transcript Het
Golga1 A G 2: 39,023,249 M542T probably benign Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
Jazf1 G A 6: 52,812,181 H103Y probably damaging Het
Klhl12 T C 1: 134,488,974 V478A possibly damaging Het
Lpcat2b A T 5: 107,433,464 T220S probably damaging Het
Myocd C T 11: 65,184,516 C594Y probably damaging Het
Nf1 A G 11: 79,440,909 E700G probably damaging Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Olfr625-ps1 T C 7: 103,683,471 V251A possibly damaging Het
Papln A G 12: 83,782,916 Q937R probably damaging Het
Pex14 T C 4: 148,967,572 R147G probably damaging Het
Plppr3 A T 10: 79,867,540 Y37N probably damaging Het
Polr1b A G 2: 129,113,734 T522A probably benign Het
Ppp3cb T C 14: 20,524,424 N201S probably damaging Het
Prf1 A G 10: 61,303,550 D429G probably damaging Het
Ptprn2 T C 12: 117,184,722 S701P probably damaging Het
Rp1l1 C T 14: 64,030,892 T1309I possibly damaging Het
Sipa1l1 T A 12: 82,440,893 M1647K probably damaging Het
Skint11 T C 4: 114,231,766 probably null Het
Slc8a2 T C 7: 16,140,597 Y257H probably benign Het
Slfn1 T A 11: 83,121,355 I99N probably damaging Het
Slit2 A G 5: 48,192,249 T282A probably damaging Het
Slit3 A T 11: 35,570,621 D228V probably damaging Het
Specc1l A G 10: 75,307,238 N1031S probably benign Het
Supt6 A G 11: 78,216,203 probably null Het
Tdrd1 G A 19: 56,851,358 E617K probably damaging Het
Tex15 C G 8: 33,576,852 F2103L probably damaging Het
Trim21 T A 7: 102,559,576 Q312L possibly damaging Het
Trim56 C T 5: 137,113,937 A242T probably benign Het
Usp4 T C 9: 108,372,674 V467A probably benign Het
Vstm4 T C 14: 32,863,554 V26A probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfat T A 15: 68,178,751 K807I probably damaging Het
Other mutations in Vmn2r65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Vmn2r65 APN 7 84943553 missense probably damaging 0.99
IGL01104:Vmn2r65 APN 7 84940788 missense possibly damaging 0.93
IGL01154:Vmn2r65 APN 7 84943521 missense probably benign 0.00
IGL01453:Vmn2r65 APN 7 84940500 missense probably damaging 1.00
IGL01675:Vmn2r65 APN 7 84947379 missense probably benign 0.00
IGL01748:Vmn2r65 APN 7 84940299 missense probably damaging 1.00
IGL01997:Vmn2r65 APN 7 84940770 missense probably damaging 1.00
IGL02527:Vmn2r65 APN 7 84946516 missense possibly damaging 0.82
IGL02617:Vmn2r65 APN 7 84940341 missense probably damaging 1.00
IGL02676:Vmn2r65 APN 7 84940173 missense possibly damaging 0.86
IGL03084:Vmn2r65 APN 7 84943146 missense probably damaging 1.00
A4554:Vmn2r65 UTSW 7 84946583 missense probably damaging 0.96
R0322:Vmn2r65 UTSW 7 84946548 missense probably benign 0.01
R0453:Vmn2r65 UTSW 7 84946234 missense probably benign 0.03
R0862:Vmn2r65 UTSW 7 84943645 missense probably benign 0.00
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1392:Vmn2r65 UTSW 7 84947416 missense probably benign 0.14
R1687:Vmn2r65 UTSW 7 84940818 missense probably benign 0.02
R1876:Vmn2r65 UTSW 7 84946297 missense probably damaging 1.00
R2136:Vmn2r65 UTSW 7 84943573 missense probably damaging 0.96
R2259:Vmn2r65 UTSW 7 84940911 missense possibly damaging 0.86
R2338:Vmn2r65 UTSW 7 84940843 missense possibly damaging 0.86
R2880:Vmn2r65 UTSW 7 84963886 missense probably damaging 1.00
R3410:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3411:Vmn2r65 UTSW 7 84946688 missense probably benign 0.00
R3770:Vmn2r65 UTSW 7 84940415 missense probably damaging 1.00
R3800:Vmn2r65 UTSW 7 84940530 missense possibly damaging 0.93
R3850:Vmn2r65 UTSW 7 84946651 missense probably benign 0.00
R4105:Vmn2r65 UTSW 7 84946483 missense probably benign 0.03
R4568:Vmn2r65 UTSW 7 84947469 missense probably damaging 1.00
R4677:Vmn2r65 UTSW 7 84963874 missense possibly damaging 0.55
R4768:Vmn2r65 UTSW 7 84947394 missense probably damaging 1.00
R4778:Vmn2r65 UTSW 7 84943593 missense possibly damaging 0.47
R5057:Vmn2r65 UTSW 7 84940611 missense probably damaging 1.00
R5279:Vmn2r65 UTSW 7 84940641 missense probably damaging 1.00
R5280:Vmn2r65 UTSW 7 84946334 missense probably damaging 0.99
R5394:Vmn2r65 UTSW 7 84946654 missense probably benign 0.04
R5487:Vmn2r65 UTSW 7 84946321 missense possibly damaging 0.76
R5580:Vmn2r65 UTSW 7 84947594 missense probably damaging 0.99
R5638:Vmn2r65 UTSW 7 84940839 missense probably damaging 1.00
R5673:Vmn2r65 UTSW 7 84947407 missense probably benign 0.23
R5688:Vmn2r65 UTSW 7 84940692 missense probably benign 0.00
R5935:Vmn2r65 UTSW 7 84943661 missense probably benign 0.00
R6354:Vmn2r65 UTSW 7 84940366 missense probably benign 0.35
R6372:Vmn2r65 UTSW 7 84940653 missense probably damaging 1.00
R6924:Vmn2r65 UTSW 7 84963990 missense probably benign 0.20
R7021:Vmn2r65 UTSW 7 84947379 missense probably benign 0.00
X0067:Vmn2r65 UTSW 7 84940905 missense probably benign 0.04
Z1088:Vmn2r65 UTSW 7 84943265 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGCTAATAAGCCCAAGTAACCCAG -3'
(R):5'- GGCGAATAACCGACTTCTCAGCTAC -3'

Sequencing Primer
(F):5'- AGTAACCCAGTACACAGTAGAATG -3'
(R):5'- AACCGACTTCTCAGCTACATTCTTC -3'
Posted On2014-04-13