Incidental Mutation 'R1509:Galnt13'
ID168111
Institutional Source Beutler Lab
Gene Symbol Galnt13
Ensembl Gene ENSMUSG00000060988
Gene Namepolypeptide N-acetylgalactosaminyltransferase 13
Synonymspp-GalNAc-T13
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location54436317-55118309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54733082 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 80 (I80T)
Ref Sequence ENSEMBL: ENSMUSP00000115879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636] [ENSMUST00000136642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068595
AA Change: I80T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: I80T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112634
AA Change: I80T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: I80T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 367 2.7e-10 PFAM
Pfam:Glycos_transf_2 118 302 1.8e-38 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.2e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.9e-10 PFAM
RICIN 427 586 5.34e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112635
AA Change: I80T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: I80T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112636
AA Change: I80T

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: I80T

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 115 368 1.5e-11 PFAM
Pfam:Glycos_transf_2 118 302 7.4e-35 PFAM
Pfam:Glyco_tranf_2_2 118 343 3.1e-7 PFAM
Pfam:Glyco_transf_7C 280 348 4.8e-9 PFAM
RICIN 427 550 9.63e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136642
AA Change: I80T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115879
Gene: ENSMUSG00000060988
AA Change: I80T

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Galnt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Galnt13 APN 2 54516535 utr 5 prime probably benign
IGL00769:Galnt13 APN 2 54880104 missense probably benign 0.37
IGL01533:Galnt13 APN 2 54880132 missense probably damaging 1.00
IGL01862:Galnt13 APN 2 54857914 missense probably damaging 1.00
IGL02363:Galnt13 APN 2 55112860 missense probably damaging 1.00
IGL02493:Galnt13 APN 2 54880137 missense probably benign 0.05
IGL03108:Galnt13 APN 2 54854648 missense probably benign 0.02
IGL03219:Galnt13 APN 2 54933435 missense possibly damaging 0.85
R0142:Galnt13 UTSW 2 55098603 missense probably damaging 1.00
R0324:Galnt13 UTSW 2 54854616 missense probably benign 0.01
R0379:Galnt13 UTSW 2 55060492 missense possibly damaging 0.72
R1321:Galnt13 UTSW 2 55098594 missense probably damaging 0.98
R1521:Galnt13 UTSW 2 54854645 missense probably benign
R1539:Galnt13 UTSW 2 54857857 missense probably damaging 1.00
R1638:Galnt13 UTSW 2 54854655 missense probably damaging 1.00
R1640:Galnt13 UTSW 2 55060546 missense probably damaging 1.00
R2299:Galnt13 UTSW 2 55060583 missense possibly damaging 0.61
R2365:Galnt13 UTSW 2 54854697 missense possibly damaging 0.85
R2367:Galnt13 UTSW 2 55112944 missense probably benign 0.00
R3687:Galnt13 UTSW 2 54880062 missense probably benign 0.31
R3726:Galnt13 UTSW 2 55098657 missense probably damaging 1.00
R3730:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R3731:Galnt13 UTSW 2 54933507 missense possibly damaging 0.91
R4626:Galnt13 UTSW 2 54857866 missense probably damaging 1.00
R4880:Galnt13 UTSW 2 55060572 missense probably damaging 1.00
R4928:Galnt13 UTSW 2 54516565 missense probably damaging 1.00
R5421:Galnt13 UTSW 2 54857896 missense probably damaging 1.00
R6136:Galnt13 UTSW 2 54516479 start gained probably benign
R6244:Galnt13 UTSW 2 54933548 missense probably damaging 1.00
R6725:Galnt13 UTSW 2 54855232 missense probably damaging 1.00
R7058:Galnt13 UTSW 2 55098575 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACCAGTGTGAAACTCCTTTTAAGCCA -3'
(R):5'- TGCATTTCATAGGCTTTCAGAACCCA -3'

Sequencing Primer
(F):5'- GGGTTTGCTTATTCTTCAAGTTCAC -3'
(R):5'- GCACAGGCAAACTTACCCTT -3'
Posted On2014-04-13