Mutagenetix > Incidental Mutation

Incidental Mutation 'R1509:Dmbt1'

168140

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

Crpd, gp300, hensin, CRP-[b], MUCLIN, ebnerin, CRP-[a], vomeroglandin

MMRRC Submission

039556-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.187) question?

Stock #

R1509 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130633787-130723357 bp(+) (GRCm39)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 130676061 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000084509
AA Change: V639M

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: V639M

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208311
AA Change: V650M

Predicted Effect

probably benign
Transcript: ENSMUST00000213064

Meta Mutation Damage Score

0.1561

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,340,766 (GRCm39)	S132P	probably benign	Het
AC153895.1	T	C	6: 50,020,451 (GRCm39)	R54G	unknown	Het
Acot12	G	A	13: 91,919,994 (GRCm39)		probably null	Het
Adhfe1	T	A	1: 9,623,671 (GRCm39)	D98E	probably benign	Het
Ago2	A	G	15: 72,988,213 (GRCm39)	F594S	probably damaging	Het
Aldh18a1	A	G	19: 40,545,927 (GRCm39)	I620T	probably damaging	Het
Aspscr1	C	A	11: 120,592,342 (GRCm39)	A294D	probably damaging	Het
Bod1l	C	G	5: 41,976,883 (GRCm39)	R1477T	probably damaging	Het
Ccdc18	C	A	5: 108,336,844 (GRCm39)	A741D	possibly damaging	Het
Ces4a	G	A	8: 105,864,729 (GRCm39)	G69S	probably damaging	Het
Cfap52	C	T	11: 67,829,819 (GRCm39)	V317I	probably benign	Het
Cgn	A	T	3: 94,681,568 (GRCm39)	L509Q	probably benign	Het
Crb2	A	G	2: 37,676,631 (GRCm39)	H204R	probably benign	Het
Cspg4b	A	G	13: 113,504,790 (GRCm39)	N431S	probably damaging	Het
Ddx39a	G	A	8: 84,446,527 (GRCm39)	V99M	probably damaging	Het
Dis3l2	T	A	1: 86,948,808 (GRCm39)	C582S	possibly damaging	Het
Dnah6	T	C	6: 73,004,425 (GRCm39)	E3846G	probably damaging	Het
Dstyk	A	G	1: 132,384,084 (GRCm39)	E655G	probably damaging	Het
Epha4	T	C	1: 77,357,523 (GRCm39)	Y825C	probably damaging	Het
Esp36	T	A	17: 38,728,173 (GRCm39)	N36I	probably damaging	Het
Fabp3	C	T	4: 130,206,180 (GRCm39)	T57I	probably benign	Het
Fem1c	A	G	18: 46,657,280 (GRCm39)	S145P	probably benign	Het
Galnt13	T	C	2: 54,623,094 (GRCm39)	I80T	probably damaging	Het
Gm5698	T	C	1: 31,016,728 (GRCm39)	T108A	probably benign	Het
Hipk3	A	G	2: 104,271,607 (GRCm39)	S442P	probably benign	Het
Hmcn2	T	A	2: 31,204,491 (GRCm39)	V22D	possibly damaging	Het
Hspg2	C	T	4: 137,238,552 (GRCm39)		probably benign	Het
Ide	A	G	19: 37,262,603 (GRCm39)		probably null	Het
Ifnar1	C	A	16: 91,300,384 (GRCm39)	P462Q	probably damaging	Het
Itgb2l	T	A	16: 96,228,049 (GRCm39)	I485F	probably benign	Het
Jakmip3	C	T	7: 138,629,505 (GRCm39)	R549W	possibly damaging	Het
Lrrc36	A	G	8: 106,187,761 (GRCm39)	Q680R	probably damaging	Het
Lysmd3	T	G	13: 81,817,390 (GRCm39)	H122Q	probably benign	Het
Macf1	C	A	4: 123,577,802 (GRCm39)	V61L	possibly damaging	Het
Map1b	T	C	13: 99,568,036 (GRCm39)	T1562A	unknown	Het
Map3k20	A	T	2: 72,194,968 (GRCm39)		probably benign	Het
Mroh8	A	G	2: 157,075,125 (GRCm39)	V457A	probably benign	Het
Mrpl40	T	A	16: 18,694,159 (GRCm39)		probably null	Het
Ms4a10	C	T	19: 10,941,472 (GRCm39)	V166I	probably benign	Het
Mycl	A	G	4: 122,894,100 (GRCm39)	D300G	probably damaging	Het
Naca	T	A	10: 127,879,266 (GRCm39)		probably benign	Het
Ncoa4	T	C	14: 31,895,391 (GRCm39)	S172P	probably damaging	Het
Nfatc3	T	C	8: 106,810,486 (GRCm39)	F421L	possibly damaging	Het
Nucb1	C	A	7: 45,144,649 (GRCm39)	K301N	probably benign	Het
Or1af1	A	G	2: 37,109,966 (GRCm39)	H155R	probably damaging	Het
Or52ae9	A	T	7: 103,390,243 (GRCm39)	M68K	probably benign	Het
Or5b99	T	A	19: 12,976,815 (GRCm39)	I155N	possibly damaging	Het
Panx1	A	T	9: 14,921,341 (GRCm39)	V178E	possibly damaging	Het
Pkd1l3	G	A	8: 110,367,402 (GRCm39)	V1210I	probably damaging	Het
Polr2a	A	T	11: 69,638,039 (GRCm39)	H143Q	possibly damaging	Het
Potefam1	A	T	2: 111,048,972 (GRCm39)	M269K	probably benign	Het
Prdm12	G	A	2: 31,544,186 (GRCm39)	R263H	probably damaging	Het
Prkdc	A	C	16: 15,549,430 (GRCm39)	K1998T	probably damaging	Het
Rab11fip1	A	T	8: 27,643,051 (GRCm39)	S583T	probably damaging	Het
Rnf157	T	A	11: 116,237,921 (GRCm39)	T567S	probably benign	Het
Rp1	T	C	1: 4,417,917 (GRCm39)	K1065R	probably damaging	Het
Rp1	A	G	1: 4,418,760 (GRCm39)	I784T	probably benign	Het
Rps10	A	C	17: 27,850,182 (GRCm39)	F150V	probably benign	Het
Rrp12	A	T	19: 41,870,639 (GRCm39)	F499I	probably damaging	Het
Sez6l2	G	A	7: 126,562,535 (GRCm39)	R604H	probably damaging	Het
Slc25a21	G	T	12: 56,904,864 (GRCm39)	Q57K	probably benign	Het
Slc27a2	A	G	2: 126,395,234 (GRCm39)	T54A	possibly damaging	Het
Slc9a9	T	A	9: 95,111,011 (GRCm39)	S610T	probably benign	Het
Smc1b	A	T	15: 84,970,335 (GRCm39)	S973T	probably benign	Het
Smc6	G	A	12: 11,329,734 (GRCm39)	S164N	possibly damaging	Het
Sp1	A	G	15: 102,316,314 (GRCm39)	T32A	possibly damaging	Het
Spen	T	C	4: 141,202,946 (GRCm39)	I1894V	probably benign	Het
Spen	T	C	4: 141,203,011 (GRCm39)	K1872R	possibly damaging	Het
Stab1	C	A	14: 30,873,541 (GRCm39)		probably benign	Het
Taar7d	T	G	10: 23,904,102 (GRCm39)	F328C	probably damaging	Het
Ticam1	A	T	17: 56,578,113 (GRCm39)	S327R	probably benign	Het
Tmem248	C	T	5: 130,258,295 (GRCm39)		probably benign	Het
Tom1	T	C	8: 75,781,259 (GRCm39)	S83P	probably damaging	Het
Txk	T	A	5: 72,856,453 (GRCm39)	Y446F	probably damaging	Het
Ubap1l	T	A	9: 65,279,237 (GRCm39)	C179S	probably benign	Het
Utrn	T	C	10: 12,331,185 (GRCm39)	E474G	possibly damaging	Het
Vmn2r14	T	C	5: 109,363,862 (GRCm39)	M685V	probably benign	Het
Vmn2r7	A	T	3: 64,623,881 (GRCm39)	Y146*	probably null	Het
Wdr1	G	A	5: 38,697,905 (GRCm39)	T220M	probably damaging	Het
Xpo7	T	C	14: 70,915,582 (GRCm39)	D726G	probably damaging	Het
Zbtb14	C	G	17: 69,694,759 (GRCm39)	I152M	probably benign	Het
Zbtb3	A	G	19: 8,780,771 (GRCm39)	D128G	probably damaging	Het
Zeb1os1	A	G	18: 5,583,794 (GRCm39)		noncoding transcript	Het
Zfp462	T	A	4: 55,007,667 (GRCm39)	D35E	probably damaging	Het
Zfp467	A	G	6: 48,415,621 (GRCm39)	S344P	possibly damaging	Het
Zfpm1	A	T	8: 123,034,285 (GRCm39)	D73V	possibly damaging	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	130,681,270 (GRCm39)	intron	probably benign
IGL00161:Dmbt1	APN	7	130,711,357 (GRCm39)	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	130,701,020 (GRCm39)	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	130,684,230 (GRCm39)	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	130,699,337 (GRCm39)	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	130,659,888 (GRCm39)	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	130,687,098 (GRCm39)	splice site	probably benign
IGL01317:Dmbt1	APN	7	130,642,921 (GRCm39)	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	130,690,497 (GRCm39)	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	130,705,409 (GRCm39)	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	130,718,457 (GRCm39)	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	130,682,915 (GRCm39)	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	130,676,149 (GRCm39)	intron	probably benign
IGL02160:Dmbt1	APN	7	130,684,418 (GRCm39)	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	130,694,986 (GRCm39)	splice site	probably benign
IGL02197:Dmbt1	APN	7	130,687,152 (GRCm39)	splice site	probably benign
IGL02332:Dmbt1	APN	7	130,668,343 (GRCm39)	intron	probably benign
IGL02427:Dmbt1	APN	7	130,689,815 (GRCm39)	splice site	probably null
IGL02726:Dmbt1	APN	7	130,676,140 (GRCm39)	intron	probably benign
IGL02967:Dmbt1	APN	7	130,672,919 (GRCm39)	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	130,684,409 (GRCm39)	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	130,712,778 (GRCm39)	missense	probably damaging	0.99
cavity	UTSW	7	130,713,965 (GRCm39)	missense	unknown
lacunar	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	130,713,805 (GRCm39)	nonsense	probably null
K3955:Dmbt1	UTSW	7	130,721,293 (GRCm39)	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	130,721,225 (GRCm39)	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	130,708,123 (GRCm39)	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	130,697,779 (GRCm39)	splice site	probably benign
R0427:Dmbt1	UTSW	7	130,642,632 (GRCm39)	nonsense	probably null
R0478:Dmbt1	UTSW	7	130,642,917 (GRCm39)	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	130,699,403 (GRCm39)	splice site	probably null
R0538:Dmbt1	UTSW	7	130,651,631 (GRCm39)	splice site	probably benign
R0626:Dmbt1	UTSW	7	130,703,811 (GRCm39)	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	130,699,383 (GRCm39)	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	130,694,847 (GRCm39)	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	130,676,254 (GRCm39)	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	130,651,944 (GRCm39)	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	130,646,217 (GRCm39)	splice site	probably benign
R1463:Dmbt1	UTSW	7	130,711,366 (GRCm39)	critical splice donor site	probably null
R1990:Dmbt1	UTSW	7	130,660,018 (GRCm39)	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	130,712,718 (GRCm39)	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	130,708,089 (GRCm39)	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	130,707,900 (GRCm39)	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	130,700,863 (GRCm39)	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	130,651,748 (GRCm39)	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	130,703,762 (GRCm39)	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	130,699,305 (GRCm39)	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	130,648,292 (GRCm39)	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	130,692,224 (GRCm39)	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	130,708,198 (GRCm39)	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	130,696,464 (GRCm39)	nonsense	probably null
R3014:Dmbt1	UTSW	7	130,633,827 (GRCm39)	intron	probably benign
R3155:Dmbt1	UTSW	7	130,651,887 (GRCm39)	nonsense	probably null
R3176:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	130,689,801 (GRCm39)	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	130,707,979 (GRCm39)	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	130,713,819 (GRCm39)	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	130,675,932 (GRCm39)	intron	probably benign
R4396:Dmbt1	UTSW	7	130,718,361 (GRCm39)	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	130,642,664 (GRCm39)	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	130,651,742 (GRCm39)	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	130,696,472 (GRCm39)	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	130,699,400 (GRCm39)	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	130,696,465 (GRCm39)	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	130,684,349 (GRCm39)	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	130,642,751 (GRCm39)	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	130,721,240 (GRCm39)	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	130,642,723 (GRCm39)	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	130,665,133 (GRCm39)	intron	probably benign
R5526:Dmbt1	UTSW	7	130,642,920 (GRCm39)	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	130,701,030 (GRCm39)	nonsense	probably null
R5566:Dmbt1	UTSW	7	130,708,003 (GRCm39)	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	130,655,797 (GRCm39)	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	130,711,370 (GRCm39)	splice site	probably null
R6188:Dmbt1	UTSW	7	130,699,361 (GRCm39)	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	130,668,463 (GRCm39)	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	130,705,308 (GRCm39)	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	130,718,370 (GRCm39)	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	130,648,240 (GRCm39)	splice site	probably null
R6719:Dmbt1	UTSW	7	130,721,332 (GRCm39)	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	130,648,291 (GRCm39)	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	130,668,464 (GRCm39)	nonsense	probably null
R7191:Dmbt1	UTSW	7	130,646,250 (GRCm39)	missense	unknown
R7269:Dmbt1	UTSW	7	130,668,351 (GRCm39)	missense	unknown
R7288:Dmbt1	UTSW	7	130,685,519 (GRCm39)	nonsense	probably null
R7296:Dmbt1	UTSW	7	130,713,861 (GRCm39)	missense	unknown
R7349:Dmbt1	UTSW	7	130,642,854 (GRCm39)	missense	unknown
R7386:Dmbt1	UTSW	7	130,713,965 (GRCm39)	missense	unknown
R7428:Dmbt1	UTSW	7	130,710,192 (GRCm39)	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	130,681,241 (GRCm39)	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	130,668,192 (GRCm39)	missense	unknown
R7513:Dmbt1	UTSW	7	130,692,242 (GRCm39)	missense	unknown
R7553:Dmbt1	UTSW	7	130,706,597 (GRCm39)	missense	unknown
R7567:Dmbt1	UTSW	7	130,663,093 (GRCm39)	splice site	probably null
R7584:Dmbt1	UTSW	7	130,690,481 (GRCm39)	nonsense	probably null
R7736:Dmbt1	UTSW	7	130,718,625 (GRCm39)	missense	unknown
R7758:Dmbt1	UTSW	7	130,722,926 (GRCm39)	missense	unknown
R7928:Dmbt1	UTSW	7	130,639,620 (GRCm39)	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	130,690,500 (GRCm39)	missense	unknown
R8098:Dmbt1	UTSW	7	130,710,188 (GRCm39)	nonsense	probably null
R8125:Dmbt1	UTSW	7	130,700,953 (GRCm39)	missense	unknown
R8177:Dmbt1	UTSW	7	130,708,162 (GRCm39)	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	130,668,330 (GRCm39)	missense	unknown
R8378:Dmbt1	UTSW	7	130,708,195 (GRCm39)	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8400:Dmbt1	UTSW	7	130,684,317 (GRCm39)	missense	unknown
R8445:Dmbt1	UTSW	7	130,692,110 (GRCm39)	missense	unknown
R8450:Dmbt1	UTSW	7	130,687,147 (GRCm39)	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	130,703,742 (GRCm39)	missense	unknown
R8688:Dmbt1	UTSW	7	130,659,984 (GRCm39)	missense	unknown
R8850:Dmbt1	UTSW	7	130,692,134 (GRCm39)	missense	unknown
R8852:Dmbt1	UTSW	7	130,642,853 (GRCm39)	missense	unknown
R8871:Dmbt1	UTSW	7	130,718,597 (GRCm39)	missense	unknown
R8943:Dmbt1	UTSW	7	130,721,372 (GRCm39)	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	130,639,611 (GRCm39)	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	130,713,798 (GRCm39)	missense	unknown
R9020:Dmbt1	UTSW	7	130,712,787 (GRCm39)	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	130,718,418 (GRCm39)	missense	unknown
R9230:Dmbt1	UTSW	7	130,639,642 (GRCm39)	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	130,700,855 (GRCm39)	missense	unknown
R9377:Dmbt1	UTSW	7	130,694,832 (GRCm39)	missense	unknown
R9428:Dmbt1	UTSW	7	130,668,208 (GRCm39)	missense	unknown
R9474:Dmbt1	UTSW	7	130,675,987 (GRCm39)	missense	unknown
R9573:Dmbt1	UTSW	7	130,657,910 (GRCm39)	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	130,712,652 (GRCm39)	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	130,660,015 (GRCm39)	missense	unknown
R9781:Dmbt1	UTSW	7	130,639,599 (GRCm39)	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	130,713,977 (GRCm39)	nonsense	probably null
X0062:Dmbt1	UTSW	7	130,696,581 (GRCm39)	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	130,690,542 (GRCm39)	missense	unknown
Z1177:Dmbt1	UTSW	7	130,684,215 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGAGAAACCACCATGTCTTTCCAGG -3'
(R):5'- AGTGACCTAAGCTCATTGCAGCC -3'

Sequencing Primer
(F):5'- ACCATGTCTTTCCAGGAACAG -3'
(R):5'- CTGGGTCTTACCTGAACAGATGAC -3'

Posted On

2014-04-13