Incidental Mutation 'R1509:Polr2a'
ID168160
Institutional Source Beutler Lab
Gene Symbol Polr2a
Ensembl Gene ENSMUSG00000005198
Gene Namepolymerase (RNA) II (DNA directed) polypeptide A
SynonymsRpo2-1, 220kDa
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69733997-69758637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69747213 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 143 (H143Q)
Ref Sequence ENSEMBL: ENSMUSP00000071200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058470
AA Change: H143Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: H143Q

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 3.6e-39 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 2e-101 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 1.7e-70 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.7e-57 PFAM
Pfam:RNA_pol_Rpb1_R 1555 1568 2.1e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1616 1629 8.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1630 1643 1.9e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1644 1657 2.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1658 1671 2.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1672 1685 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1686 1699 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1700 1713 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1714 1727 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1728 1741 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1742 1755 5.3e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1757 1769 5.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1784 1797 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1798 1811 4.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1826 1839 4.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1841 1853 2e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1854 1867 6.9e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1868 1881 3.7e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1882 1895 1.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1896 1909 5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1924 1936 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1931 1954 2.6e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1948 1960 2.5e-3 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000071213
AA Change: H143Q

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: H143Q

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 1.8e-41 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 4.8e-104 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 5.2e-74 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.4e-55 PFAM
low complexity region 1503 1522 N/A INTRINSIC
low complexity region 1524 1549 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 1578 1591 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1592 1605 2.5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1606 1619 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1620 1633 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1634 1647 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1648 1661 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1662 1675 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1676 1689 2.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1690 1703 2.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1704 1717 5.2e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1718 1731 5.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1732 1745 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1746 1759 8.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1760 1773 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1788 1801 3.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1802 1815 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1816 1829 8.3e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1830 1843 2.2e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1844 1857 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1858 1871 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1872 1885 6e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1886 1899 4.6e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1893 1909 4.8e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1903 1916 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 1.6e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151586
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Polr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Polr2a APN 11 69743794 splice site probably benign
IGL01067:Polr2a APN 11 69748014 missense possibly damaging 0.94
IGL01547:Polr2a APN 11 69744942 missense probably damaging 0.99
IGL01589:Polr2a APN 11 69741194 missense probably benign
IGL01955:Polr2a APN 11 69741848 missense probably damaging 1.00
IGL02457:Polr2a APN 11 69743250 splice site probably benign
IGL02526:Polr2a APN 11 69739467 missense probably benign 0.03
IGL02792:Polr2a APN 11 69746112 missense probably damaging 0.99
IGL03058:Polr2a APN 11 69745047 splice site probably null
IGL03083:Polr2a APN 11 69745046 critical splice acceptor site probably null
IGL03198:Polr2a APN 11 69747281 splice site probably null
IGL03201:Polr2a APN 11 69745690 nonsense probably null
PIT4260001:Polr2a UTSW 11 69735967 missense possibly damaging 0.93
R0126:Polr2a UTSW 11 69747425 missense probably damaging 0.99
R0254:Polr2a UTSW 11 69743671 missense possibly damaging 0.75
R0313:Polr2a UTSW 11 69735080 missense unknown
R0336:Polr2a UTSW 11 69736893 missense possibly damaging 0.92
R0453:Polr2a UTSW 11 69741019 missense possibly damaging 0.65
R0762:Polr2a UTSW 11 69735117 missense unknown
R1101:Polr2a UTSW 11 69748071 missense probably benign 0.23
R1547:Polr2a UTSW 11 69734555 missense probably benign 0.39
R1567:Polr2a UTSW 11 69746031 missense probably benign 0.07
R1597:Polr2a UTSW 11 69739929 missense possibly damaging 0.88
R1614:Polr2a UTSW 11 69743373 missense possibly damaging 0.75
R1698:Polr2a UTSW 11 69739877 critical splice donor site probably null
R1735:Polr2a UTSW 11 69742396 missense probably damaging 0.99
R1743:Polr2a UTSW 11 69739503 missense probably damaging 0.96
R1899:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1900:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1931:Polr2a UTSW 11 69735375 missense unknown
R2217:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2218:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2245:Polr2a UTSW 11 69735183 missense unknown
R3123:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R3124:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R4018:Polr2a UTSW 11 69735059 missense unknown
R4025:Polr2a UTSW 11 69743659 missense possibly damaging 0.95
R4197:Polr2a UTSW 11 69735336 missense unknown
R4462:Polr2a UTSW 11 69746403 missense probably damaging 1.00
R4508:Polr2a UTSW 11 69742559 critical splice acceptor site probably null
R4746:Polr2a UTSW 11 69735674 missense probably benign 0.05
R5069:Polr2a UTSW 11 69736735 intron probably null
R5102:Polr2a UTSW 11 69746945 missense possibly damaging 0.93
R5195:Polr2a UTSW 11 69744079 missense probably damaging 1.00
R5234:Polr2a UTSW 11 69736840 missense probably benign 0.03
R5330:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5331:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5896:Polr2a UTSW 11 69736260 missense probably damaging 0.99
R5910:Polr2a UTSW 11 69746870 missense probably damaging 0.99
R6128:Polr2a UTSW 11 69736977 missense probably damaging 1.00
R6238:Polr2a UTSW 11 69747221 missense possibly damaging 0.95
R6244:Polr2a UTSW 11 69744226 missense probably damaging 1.00
R6303:Polr2a UTSW 11 69746913 missense probably damaging 1.00
R6338:Polr2a UTSW 11 69739679 intron probably null
R6361:Polr2a UTSW 11 69743337 missense probably damaging 0.99
R6374:Polr2a UTSW 11 69736932 missense probably damaging 0.98
R6630:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6631:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6633:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6897:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6923:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6933:Polr2a UTSW 11 69736177 missense probably damaging 0.99
R6933:Polr2a UTSW 11 69739467 missense probably benign 0.03
R6953:Polr2a UTSW 11 69741711 missense probably damaging 0.99
R6974:Polr2a UTSW 11 69747200 missense probably damaging 0.98
R7033:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R7085:Polr2a UTSW 11 69743880 missense probably damaging 0.99
R7112:Polr2a UTSW 11 69735309 missense unknown
R7124:Polr2a UTSW 11 69737462 nonsense probably null
R7319:Polr2a UTSW 11 69746370 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGGCCATTTCTGCCACACTATG -3'
(R):5'- TGAAGACAATGAAGGTTTTGCGCTG -3'

Sequencing Primer
(F):5'- CTAGAGTCACTTTCCCGCAA -3'
(R):5'- GCTCCAAACTGCTTGTAGATTCTG -3'
Posted On2014-04-13