Incidental Mutation 'R1515:Ptprt'
ID168205
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162238034 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 282 (S282T)
Ref Sequence ENSEMBL: ENSMUSP00000105071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: S282T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: S282T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: S282T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: S282T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: S282T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: S282T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: S282T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: S282T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGCATTTCCGGTTAAAACCCCTCAC -3'
(R):5'- CCTCAGCAATGGAATGGCAGAGAC -3'

Sequencing Primer
(F):5'- CGCACGCGGATAGTGTTAG -3'
(R):5'- GAGACACAGCCCTCATGGTC -3'
Posted On2014-04-13